ID: 1001843969

View in Genome Browser
Species Human (GRCh38)
Location 5:174904440-174904462
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 5, 1: 12, 2: 38, 3: 106, 4: 321}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001843964_1001843969 18 Left 1001843964 5:174904399-174904421 CCCCTCTGGGGAGGGGCAGGCAC No data
Right 1001843969 5:174904440-174904462 GACTCAGCTGTTCCAGCCTGTGG 0: 5
1: 12
2: 38
3: 106
4: 321
1001843966_1001843969 16 Left 1001843966 5:174904401-174904423 CCTCTGGGGAGGGGCAGGCACCA No data
Right 1001843969 5:174904440-174904462 GACTCAGCTGTTCCAGCCTGTGG 0: 5
1: 12
2: 38
3: 106
4: 321
1001843968_1001843969 -4 Left 1001843968 5:174904421-174904443 CCATTTCTACTGCTAGGTTGACT No data
Right 1001843969 5:174904440-174904462 GACTCAGCTGTTCCAGCCTGTGG 0: 5
1: 12
2: 38
3: 106
4: 321
1001843962_1001843969 24 Left 1001843962 5:174904393-174904415 CCGGAGCCCCTCTGGGGAGGGGC No data
Right 1001843969 5:174904440-174904462 GACTCAGCTGTTCCAGCCTGTGG 0: 5
1: 12
2: 38
3: 106
4: 321
1001843965_1001843969 17 Left 1001843965 5:174904400-174904422 CCCTCTGGGGAGGGGCAGGCACC No data
Right 1001843969 5:174904440-174904462 GACTCAGCTGTTCCAGCCTGTGG 0: 5
1: 12
2: 38
3: 106
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001843969 Original CRISPR GACTCAGCTGTTCCAGCCTG TGG Intergenic
900386661 1:2413803-2413825 GACTGGGCTGTGCCAGTCTGGGG - Intergenic
900620081 1:3582705-3582727 GACTCAGCTCTCCCTGCTTGGGG + Intronic
901236973 1:7672353-7672375 GACTCAGCTGGCCCAGCCTGGGG - Intronic
901704358 1:11062096-11062118 GACAAAGCTGCTCCAGCATGTGG + Intergenic
901738138 1:11325245-11325267 GAATCAGATGTCCCGGCCTGAGG + Intergenic
902287235 1:15414439-15414461 GTCCCCGCTGTTCCAGCGTGAGG - Intronic
902287554 1:15416376-15416398 AACTCAGCTGCTCCAGGGTGTGG - Intronic
902512048 1:16971903-16971925 GCCTCAGCAGCTCCAGCCTCAGG + Intronic
903310042 1:22448060-22448082 GACTCAGCTTTTGCAGCCCAAGG + Intergenic
904175297 1:28623813-28623835 GTCTCAGCTGCTCCAGACTAGGG - Intronic
904425009 1:30417429-30417451 GACTTAGCTGTTTCTGCCTGTGG - Intergenic
905126949 1:35722197-35722219 GACTCAGCTATTCCAGGCTGGGG - Intronic
905848817 1:41257899-41257921 GACTTAGCTGTTCCAGCCTTTGG - Intergenic
906858379 1:49331969-49331991 GACTCAGCCATTCCAGCCTGAGG + Intronic
907526268 1:55056012-55056034 AAGCCAGCTGGTCCAGCCTGTGG + Exonic
907623881 1:56010068-56010090 GACTTAGCCATTCCAGCCTTGGG + Intergenic
907664790 1:56425258-56425280 GTCACATCTGTTCAAGCCTGTGG - Intergenic
908865861 1:68548044-68548066 AACTCAGCCATTCCAGCCTGTGG + Intergenic
909720901 1:78767937-78767959 AACTCAGCCATTCCAGCTTGTGG + Intergenic
909759677 1:79271700-79271722 AACTCAGCCATTCCAGCCTTTGG + Intergenic
909759723 1:79271968-79271990 AACTTAGCCATTCCAGCCTGTGG + Intergenic
909844512 1:80374985-80375007 GACACAGCTGTTCCAGACAAGGG + Intergenic
910641992 1:89473504-89473526 AACTCAGCCATTCCAGCCTGTGG + Intergenic
911149029 1:94579709-94579731 ATCTCAGCTGGTCCAGCCTGAGG - Intergenic
911674847 1:100647393-100647415 GACTCAGTCGTTCCAGCCTATGG + Intergenic
911794504 1:102058910-102058932 AACTCTGCTTTTCCAGCCTATGG + Intergenic
912893117 1:113557085-113557107 GACTCAGCCATTCCAGCCTGCGG + Intronic
913123657 1:115765482-115765504 TCCTCAGGTGTTTCAGCCTGGGG + Intronic
913319794 1:117580201-117580223 GACCCTGCTCCTCCAGCCTGGGG + Intergenic
913430793 1:118788831-118788853 GACTCAGCCATTCCAGCCTGGGG + Intergenic
913430844 1:118789092-118789114 GACTCAGTTGATCCAGCCTGTGG + Intergenic
915310278 1:155002905-155002927 GCCTCAGCAGCTCCAGCCAGCGG + Exonic
915343014 1:155186444-155186466 TTCTCTGCTGTTCCAGCCTAAGG + Intronic
916594785 1:166233752-166233774 AACTCAGCAATTCCAGCCTATGG - Intergenic
916985900 1:170191395-170191417 TTCTTAGCTGGTCCAGCCTGAGG - Intergenic
916986006 1:170191905-170191927 AACTCAGCAGTTCCAGCCTTTGG - Intergenic
917289808 1:173460741-173460763 GACTCAGCCATTCCAACCAGTGG + Intergenic
917530487 1:175830694-175830716 GACTCTGCAGCTCCAGCCAGTGG - Intergenic
917714665 1:177722130-177722152 GACTTAGCTGTTCCAACCTTTGG + Intergenic
919260674 1:195190284-195190306 GACTTAGCTCTTCCACCCTTTGG + Intergenic
920786857 1:209050503-209050525 AACTTAACTGTTCCAGCCTTTGG + Intergenic
920915945 1:210258075-210258097 GTATCATCTGTCCCAGCCTGTGG - Intergenic
921286551 1:213614779-213614801 GACTGGGCTCTTTCAGCCTGTGG + Intergenic
922022044 1:221715415-221715437 GACTGAGCTACTCCAGCCGGCGG - Intronic
922586524 1:226738008-226738030 GACTCAGCTCTCCCGGGCTGAGG + Intronic
1065412946 10:25450283-25450305 CCCTCAGCTCTTCCAGCCTTGGG - Intronic
1065825890 10:29571196-29571218 GTCTGAGCTATTCCAGCCAGTGG - Intronic
1065951469 10:30655461-30655483 GTCTGAGCTATTCCAGCCAGTGG + Intergenic
1066509786 10:36083414-36083436 AACTCAGCCATTCCAACCTGTGG - Intergenic
1069340458 10:67403088-67403110 AACTCAGCTGTTCAAGTCTGTGG + Intronic
1069663868 10:70142276-70142298 GACTCAGCTGCTGCAGACTGTGG - Intronic
1069759411 10:70798332-70798354 GATTCAGCCGTTCCAGCCTGTGG - Intergenic
1069819875 10:71220828-71220850 GTCTCAGCTGCTCCTGGCTGAGG + Intronic
1070054706 10:72923817-72923839 AACTCAGCCATTCCAGCCTGTGG - Intronic
1073783535 10:106864771-106864793 GACTTAGCTTTTTCAGCCTTCGG + Intronic
1076133290 10:128028393-128028415 GGCCCAGCAATTCCAGCCTGGGG - Intronic
1076333724 10:129691231-129691253 GACACAGCTGTGCCACACTGGGG - Intronic
1076716350 10:132366186-132366208 CACCCAGCTGATCCAGGCTGTGG + Intronic
1076815025 10:132910338-132910360 GGCTCAGCTGCTCCTTCCTGCGG - Intronic
1077340012 11:2022046-2022068 GACTCAGCTGTGAGGGCCTGTGG + Intergenic
1077396456 11:2325868-2325890 GACCCAGCAGATCCAGTCTGAGG + Intergenic
1078033697 11:7780674-7780696 AACTCAGTTGTTCCAGTCTGTGG + Intergenic
1079478630 11:20858067-20858089 GTCTGTGCTGTCCCAGCCTGTGG - Intronic
1080513792 11:33001289-33001311 GACTCAGCCATTCCAGCCTGCGG - Intergenic
1080513834 11:33001544-33001566 GACTCAACCATTCCAGCCTGCGG - Intergenic
1081911992 11:46705563-46705585 GACTGAGCTGATGCCGCCTGAGG - Exonic
1083008064 11:59367638-59367660 GCCTTAGCTGTTCCGGCCTTTGG + Intergenic
1083199003 11:61108366-61108388 GAATCTGCTGTTCCTTCCTGCGG + Intronic
1083307792 11:61769985-61770007 GATTCTCCTGGTCCAGCCTGGGG + Intronic
1083780954 11:64917018-64917040 GGCTGAGCTGGTCCAGGCTGAGG + Exonic
1084416126 11:69033871-69033893 GACTTTTCTCTTCCAGCCTGGGG + Intergenic
1084777991 11:71389716-71389738 GACTCAGCTGCTCCTGGTTGAGG + Intergenic
1085642277 11:78200084-78200106 GCCTCAGCAGCTCAAGCCTGGGG + Intronic
1085820404 11:79787150-79787172 GACTCAGCTATTCTACCCTAGGG + Intergenic
1087374801 11:97327041-97327063 GACTTAGCCGTTCCAGCCTTCGG - Intergenic
1202822997 11_KI270721v1_random:77235-77257 GACTCAGCTGTGAGGGCCTGTGG + Intergenic
1093086211 12:14869027-14869049 GACTCAGCCATTCCAGCCTGTGG - Intronic
1093652387 12:21660163-21660185 GTCTGGGCTTTTCCAGCCTGTGG + Intronic
1093731761 12:22573290-22573312 GGCACAGCTGCTGCAGCCTGTGG + Intergenic
1095511124 12:42952803-42952825 GTCCCAGCTGTTCCAGCCATGGG + Intergenic
1095824394 12:46516415-46516437 AACTTAACTGTTCCAGCCTTTGG - Intergenic
1096080497 12:48829322-48829344 GACCCAGCTGTATCAGGCTGTGG - Intergenic
1096220781 12:49827393-49827415 GACTCAGCTGATCCAGCCCTGGG + Intronic
1096517624 12:52165820-52165842 TCCTCATCTGTTCCGGCCTGAGG - Intergenic
1097224539 12:57469622-57469644 GATGTAGCTGGTCCAGCCTGAGG - Exonic
1097582942 12:61480981-61481003 GACTCAGCTGTTCCAACCTGTGG + Intergenic
1098128377 12:67323054-67323076 GACTTAGCTGTTCCAGCCTTTGG + Intergenic
1098544924 12:71701010-71701032 GACTCACCAGTTTCAACCTGTGG - Exonic
1100156431 12:91805015-91805037 TCCTCAGCTGGTCCAGCCTGGGG + Intergenic
1100982280 12:100171133-100171155 GTCTCACCTAGTCCAGCCTGGGG - Intergenic
1102460569 12:113097261-113097283 GTCTCTTCTCTTCCAGCCTGGGG - Exonic
1103216296 12:119203866-119203888 GGCTCATCTCTTCCAGGCTGTGG - Intronic
1108297815 13:49042257-49042279 TACTTACCTTTTCCAGCCTGGGG - Intronic
1109361506 13:61299712-61299734 GTCTCAGCCAGTCCAGCCTGTGG + Intergenic
1111235214 13:85400490-85400512 GACTCAGCCATTCCAGCCTATGG - Intergenic
1113817844 13:113187336-113187358 GACCCAGCATTTCCACCCTGAGG - Intronic
1115428457 14:33288429-33288451 GACCAATCTGGTCCAGCCTGGGG - Intronic
1115967753 14:38911611-38911633 GACTTAGCAGTTCCAGGCTTTGG + Intergenic
1116493792 14:45536726-45536748 CACTCAGCTGTTCTAGCCTGTGG - Intergenic
1116493843 14:45536994-45537016 AACTCAGCCATTCCAGCCTGTGG - Intergenic
1117829121 14:59732971-59732993 AACTCAGCCACTCCAGCCTGCGG + Intronic
1117829283 14:59733789-59733811 TTCTCAGCTGGTCTAGCCTGTGG + Intronic
1118527353 14:66661310-66661332 AACTCAGCCATTCCAGCCTGTGG + Intronic
1118957612 14:70497350-70497372 GACTTAGCTATTCCAGCCTTTGG + Intergenic
1119117683 14:72041615-72041637 CATTGAGCTGTGCCAGCCTGGGG + Intronic
1120637874 14:86974114-86974136 AACGCAGCCATTCCAGCCTGTGG + Intergenic
1123150234 14:106174612-106174634 GGTTCAGCTGTTGCAGCCTGGGG - Intergenic
1124785629 15:32677541-32677563 GACTTAACTAATCCAGCCTGTGG + Intronic
1124923363 15:34047632-34047654 GACTCAGCCATTCTAGCTTGCGG + Intronic
1126595468 15:50380326-50380348 GACTCAGCAGTTCCAATCTTAGG + Intergenic
1126794909 15:52252667-52252689 GATTCTCCTGTTCCAGCCTCCGG - Intronic
1128676701 15:69615161-69615183 GCCTCACCTCTTCCAGCCTAGGG - Intergenic
1129971329 15:79780389-79780411 AACTCAGCCTTTCCAGCCTGTGG + Intergenic
1129982138 15:79882858-79882880 GACTAAGCTGGGCCTGCCTGGGG - Intronic
1130185458 15:81677236-81677258 GACTCAGCCACTCCAGTCTGTGG + Intergenic
1130584532 15:85170805-85170827 GACTCAGCTCTCTCAGCCTGTGG + Intergenic
1130584543 15:85170916-85170938 GACTCAGCTCTCTCAGCCTGTGG + Intergenic
1130898322 15:88188033-88188055 GGATGAGCTGGTCCAGCCTGTGG - Intronic
1131113845 15:89782021-89782043 GACTCAGCCTTTCGAGACTGTGG - Intergenic
1131590267 15:93740858-93740880 GACTTAGCTGTTCCAGCCTTTGG - Intergenic
1133514389 16:6494316-6494338 TACTGAGCAGTTCCATCCTGAGG + Intronic
1133982281 16:10642019-10642041 GTCTCAGCCCTGCCAGCCTGCGG - Intronic
1134484891 16:14649899-14649921 GGCCCAGCTGCTCCAGCCAGAGG - Exonic
1134889601 16:17828230-17828252 GACTCAGCAGTTCCAATCTTAGG + Intergenic
1136568908 16:31085254-31085276 CACTTATCTGTTTCAGCCTGTGG - Exonic
1136679817 16:31952176-31952198 GGTTCAGCTGTTGCAGCCTGGGG + Intergenic
1136890244 16:33965925-33965947 GGTTCAGCTGTTGCAGCCTGGGG - Intergenic
1137240125 16:46649033-46649055 GACCTTGCTGTGCCAGCCTGAGG + Intergenic
1137721182 16:50628391-50628413 GCCTCAGCTGCTTCAGCCTGTGG + Intronic
1138202344 16:55099584-55099606 GAATCAGCTGATCCAGGCAGTGG - Intergenic
1138292202 16:55857198-55857220 GACTCAACTCTTCCTGCCTCAGG + Intronic
1141743285 16:85908748-85908770 GACTCAGCTGTATGAACCTGGGG + Intronic
1142250878 16:88991305-88991327 CCCTCAGCTGTACCCGCCTGAGG + Intergenic
1203082787 16_KI270728v1_random:1157689-1157711 GGTTCAGCTGTTGCAGCCTGGGG + Intergenic
1143628277 17:8123060-8123082 GCCTCAGCTCTTCCAGGCTGCGG + Exonic
1144339064 17:14297804-14297826 TCCGCAGCTGCTCCAGCCTGCGG - Intergenic
1145863499 17:28226390-28226412 GACACATTTCTTCCAGCCTGTGG - Intergenic
1145980325 17:29007278-29007300 GTCACAGCTGTGCCATCCTGAGG + Intronic
1147265535 17:39232184-39232206 GACCCAGCTGAAGCAGCCTGGGG + Intergenic
1147525315 17:41216752-41216774 GACTCAAACGTTCCTGCCTGCGG + Intronic
1150013694 17:61531350-61531372 GACTCACCAGTTCCAGTTTGCGG + Intergenic
1150308422 17:64106628-64106650 AAATCAGCTGATCCATCCTGTGG - Intronic
1152290080 17:79435392-79435414 GAATCAGCTCTGGCAGCCTGTGG - Intronic
1153226092 18:2901169-2901191 GCCTTAGCTGTTAGAGCCTGTGG - Intronic
1154181850 18:12145195-12145217 GACTTAGCCATTCCAGCCTTTGG - Intergenic
1154181995 18:12146049-12146071 GACTTAGCCATTCCAGCCTTCGG + Intergenic
1155577146 18:27260013-27260035 AACTTAGCTGTTCCGGCCTTTGG - Intergenic
1156653759 18:39258462-39258484 GACTTAGCCATTCCAGCCTGTGG + Intergenic
1156700057 18:39815057-39815079 TACTCAGCTGTTGCAGCCTGTGG - Intergenic
1160182439 18:76647457-76647479 GACTTTGCCGTTCCAGCCTTTGG - Intergenic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1160710342 19:548536-548558 GCCTCAGCTGGGCCATCCTGGGG - Exonic
1161211516 19:3068378-3068400 GACTCAGCTGTCCAGCCCTGGGG + Intergenic
1163103126 19:15109355-15109377 GACTCAGCTGAGCCAGGCTGTGG - Exonic
1163154560 19:15432733-15432755 CGCTCAGCTGCTCCCGCCTGGGG - Intronic
1163968925 19:20773825-20773847 GAATAAGCTTTTCCAGCCTCTGG + Intronic
1164232453 19:23302366-23302388 AACTCAGCCATTCTAGCCTGTGG - Intergenic
1164232500 19:23302639-23302661 GACTCAGTCATTCCAGCCTGTGG - Intergenic
1164391130 19:27822264-27822286 AACTCAGCCATTCCAGCCTGTGG - Intergenic
1164391179 19:27822535-27822557 GACTCAGCCTTTCCAGCCTGTGG - Intergenic
1165899138 19:39160596-39160618 ATCACAGCTGTTCCAGCCTCCGG - Intronic
1166048348 19:40242732-40242754 CACTCAGCTGTTCGACTCTGAGG - Intronic
1166911834 19:46164396-46164418 GACTTAGCTGTTTCAGCCTTTGG - Intergenic
926987401 2:18639650-18639672 ATCTCAGCTGGTCCAGCCTGTGG - Intergenic
927096981 2:19754735-19754757 AACTCAGCAGATCCAGACTGAGG - Intergenic
927197539 2:20558775-20558797 GACTCAGCCCTCCAAGCCTGTGG + Intergenic
929237710 2:39624216-39624238 GGCTCATCTGTTCCTGCCTGGGG + Intergenic
929401105 2:41582550-41582572 ATCTCAGCTGGTCCAGCCTGTGG + Intergenic
930382766 2:50652711-50652733 GACTCAGCTGTTCCACTCATAGG - Intronic
930735345 2:54773102-54773124 GCCTCAGGAGTGCCAGCCTGTGG + Intronic
932036105 2:68248580-68248602 GATTCAGTTGTTCCAGGGTGGGG + Intronic
932831985 2:74999024-74999046 GATTCAGCAGTTGCAGACTGGGG - Intergenic
933625302 2:84590930-84590952 TTCTCAGCGGTTCCAACCTGGGG - Intronic
933714354 2:85349383-85349405 GACTCAGCTGGGAAAGCCTGTGG - Exonic
933940733 2:87242951-87242973 GAATCAGCTTTTCCATCCTATGG + Intergenic
934623610 2:95831547-95831569 GACTCAGCTATTCCAGTCTGTGG + Intergenic
934808795 2:97264639-97264661 GACACAGCCATTCCAGCCTGTGG + Intergenic
934810141 2:97270548-97270570 GACTCAGTTATTCCAGTCTGTGG - Intergenic
934810357 2:97271997-97272019 AACTTAGCTGCTCCAGCCTTCGG + Intergenic
934827335 2:97435942-97435964 AACTTAGCTGCTCCAGCCTTCGG - Intergenic
934827551 2:97437391-97437413 GACTCAGTTATTCCAGTCTGTGG + Intergenic
934828710 2:97492523-97492545 GACACAGCCATTCCAGCCTGTGG - Intergenic
936352405 2:111723062-111723084 GAATCAGCTTTTCCATCCTATGG - Intergenic
936862022 2:117029999-117030021 TACTCAGCTGTTCCAGTCTGTGG + Intergenic
938252122 2:129823304-129823326 GACACTGCTGTGCCTGCCTGTGG - Intergenic
940124529 2:150309538-150309560 AATTCAGCCATTCCAGCCTGTGG + Intergenic
940124637 2:150310060-150310082 ATCTCAGCAGGTCCAGCCTGTGG + Intergenic
940461050 2:153963436-153963458 GACTCAGCACTTCCATCCTTTGG - Intronic
940614992 2:156038645-156038667 GATTCAGCTGTTCCGGCCTGTGG + Intergenic
941289963 2:163662667-163662689 GTCCCAGCTGCTCCAGCCAGGGG + Intronic
943326908 2:186510756-186510778 GACCAAGCTTTTCCAACCTGAGG + Intergenic
943612046 2:190045307-190045329 GACTTAGCTGATCCAGCCTTTGG - Intronic
944176862 2:196839744-196839766 CTCTCAGCTGTTACTGCCTGTGG - Exonic
944315668 2:198283323-198283345 GACTCAGCAGTTCTAGAGTGGGG + Intronic
944363714 2:198891864-198891886 TTCTCAGCTGTTTCAGCCTGAGG + Intergenic
946757178 2:222959526-222959548 GTGTCAGTTGTTCCAGCCTGAGG - Intergenic
946786086 2:223246094-223246116 GACTCAGCCGTTTCAACTTGTGG - Intergenic
946786146 2:223246364-223246386 TACTCAGCCATTCCAGCCTGTGG - Intergenic
946803125 2:223442380-223442402 GGCTCTTCTGTGCCAGCCTGGGG + Intergenic
947518934 2:230829146-230829168 GACTCAGCTCTTCCTGGCTTGGG + Intergenic
948080058 2:235198495-235198517 GACGCAGCAGCCCCAGCCTGAGG - Intergenic
948767077 2:240228038-240228060 GGCGCAGCTCTTCCAGCCAGAGG + Intergenic
949070278 2:242020332-242020354 GATTCCGCTGTTCAAACCTGAGG + Intergenic
1168907225 20:1416169-1416191 GACTGAGGTCTTCCAGGCTGAGG - Intergenic
1169344185 20:4817339-4817361 GACTCAGCAGTTCCACCCCTAGG - Intronic
1170062411 20:12273056-12273078 AACTCAGCCATTCCAGCCTGTGG + Intergenic
1170603639 20:17860058-17860080 GATACAGATGGTCCAGCCTGGGG - Intergenic
1171282159 20:23910103-23910125 GACTTAGCCATTCCAGCCTTTGG - Intergenic
1174327454 20:49790612-49790634 GACTGAGATGTTCCATCTTGGGG + Intergenic
1175176463 20:57115269-57115291 GACGCAGCTGTCAGAGCCTGTGG - Intergenic
1175291400 20:57878140-57878162 GGCACAGGTGTTCCAGCCTCAGG + Intergenic
1181365884 22:22376875-22376897 GACTCTGCTCTTCCAGCGTACGG + Intergenic
1181372320 22:22428397-22428419 GACTCTGCTCTTCCAGCGTACGG + Intergenic
1181432168 22:22888223-22888245 GAAGCAGCCGATCCAGCCTGCGG + Exonic
1181542297 22:23579999-23580021 GAAGCAGCCGGTCCAGCCTGAGG - Exonic
1182420415 22:30246033-30246055 GTCCCCGCTGTTCCAGCATGGGG - Intronic
1184466445 22:44671138-44671160 GACCCTGCTGTTTGAGCCTGTGG - Intronic
1184527531 22:45034297-45034319 GACTGAGCAGATCCACCCTGGGG + Intergenic
1184668965 22:46002960-46002982 GACTCAGCTGCTTGAGCCTGGGG - Intergenic
1185000394 22:48242059-48242081 AAATCAGCTGTTCCAGGCTTTGG + Intergenic
1185068759 22:48644933-48644955 GACTCAGGGCTCCCAGCCTGTGG - Intronic
950062467 3:10083549-10083571 GACTCAGCCATTCCATCCTTAGG + Intronic
950614196 3:14146319-14146341 TACTGAGCCGTCCCAGCCTGGGG + Intronic
950923355 3:16716778-16716800 GACTTAGCCATTCCAGCCTTCGG - Intergenic
951469797 3:23044113-23044135 AACTTAGATGTTCCAGTCTGTGG + Intergenic
952548590 3:34450163-34450185 AACTTAGATGTTCCAGCCTGCGG - Intergenic
952548641 3:34450431-34450453 GACTGAGCAGTTCCAGTCTATGG - Intergenic
952673666 3:36000751-36000773 GACTCAGCTGTTCCAACCTGTGG - Intergenic
952673712 3:36001024-36001046 AACCAAGCTGTTCTAGCCTGTGG - Intergenic
952695792 3:36264143-36264165 AACTCAGCAATTGCAGCCTGTGG - Intergenic
953816623 3:46163389-46163411 GACTCAGCCATTCCAACCTGTGG - Intergenic
953816679 3:46163652-46163674 GACTCAGCCGTTCCAGCCTGTGG - Intronic
954631108 3:52048081-52048103 GGCTCACCTGATCCAGCCAGAGG + Intergenic
955374812 3:58386064-58386086 GGCTCAGCAGTCCCAGGCTGGGG - Intronic
955681398 3:61505551-61505573 GACTCAGCTGTTCTAGCCTGAGG - Intergenic
955752463 3:62196655-62196677 GACTCTGCTCTGCCAGCCTGAGG + Intronic
956757153 3:72400247-72400269 GACTTCGCTGTACGAGCCTGTGG - Intronic
956917999 3:73894174-73894196 GACTCAGTTGTTAGAGCCTATGG + Intergenic
958759605 3:98291766-98291788 AACTCAGCCATTCCAGCCTGTGG - Intergenic
959506701 3:107164331-107164353 AACTCAGCCATTCCAGCCTATGG + Intergenic
959605438 3:108236761-108236783 GACTTAGCTGTTTCAGCTTTTGG - Intergenic
960502563 3:118455072-118455094 AACTCAGCTGTTTGAGCCTGTGG - Intergenic
960685174 3:120287850-120287872 GACTTAGCTCTTCCAGCCTTTGG + Intergenic
961021968 3:123515479-123515501 GACTCAGCTGGAACAGCCTTGGG + Intronic
963056930 3:141193657-141193679 AACTTAGCTGTTCCAGTCTGTGG + Intergenic
963057089 3:141194513-141194535 GACTTAGCCGTTCCAGCCTCTGG + Intergenic
963519305 3:146345284-146345306 AACTCAGCTGTTCCAGGAAGTGG - Intergenic
963519354 3:146345541-146345563 AACTCAGCCATTCCAGCCTGGGG - Intergenic
963768429 3:149363311-149363333 GGCTCATCTCTTCCTGCCTGGGG - Intergenic
964255752 3:154772666-154772688 GACTCAGCCATTCCAGGCTTTGG - Intergenic
966200951 3:177359330-177359352 GACTTGGCTGTCGCAGCCTGGGG - Intergenic
966269749 3:178090660-178090682 AACTCAGCCATTCCAGCCTGTGG + Intergenic
967215558 3:187206990-187207012 CACCCAGCTCTTCCAGGCTGGGG + Intergenic
967574686 3:191076641-191076663 AACTCAGCCATTCCAGACTGTGG + Intergenic
967574735 3:191076886-191076908 GAATCAGCTGTTCCAGCCTGTGG + Intergenic
967574790 3:191077151-191077173 GACTCAGCTGGTCCAGACTGTGG + Intergenic
968243583 3:197117311-197117333 GACTCAGCAATTCCACCCTTAGG + Intronic
968597212 4:1491717-1491739 GACTCAGCTGTGCCACCATCAGG + Intergenic
968920531 4:3520077-3520099 GCCACAGCTTTTCCAGCCTGGGG + Exonic
968974816 4:3816531-3816553 GACCCTGCTGGGCCAGCCTGGGG + Intergenic
969116088 4:4871652-4871674 AACTCGGCTGTGCCAGCCCGGGG + Intergenic
969300262 4:6293289-6293311 GAGTCAGCGCTGCCAGCCTGTGG + Intronic
969644508 4:8419603-8419625 GACTCAGCAATTCCACTCTGAGG + Intronic
969952639 4:10853965-10853987 AATTCAGCTGTTACAGCCTGCGG - Intergenic
970221627 4:13817823-13817845 GATTCAGCTGGTCTAGCATGAGG + Intergenic
970501684 4:16683840-16683862 GACCCAGCTCTTCCTTCCTGTGG + Intronic
970968388 4:21953274-21953296 AACTCCTCTGCTCCAGCCTGTGG + Intergenic
973604992 4:52577815-52577837 GAATCAGCTGTTCCATACTAAGG - Intergenic
974991191 4:69093040-69093062 GACTTAGCAATTCCAGCCTGTGG - Intronic
975977452 4:80115611-80115633 AACTCAGCTGTTCCAGCCTGTGG + Intronic
977084391 4:92575775-92575797 ATCTCAGCTGGTCCAGACTGTGG - Intronic
977084445 4:92576039-92576061 AACTCAGCCATTCCAGCCTGTGG - Intronic
977084488 4:92576309-92576331 CAATCAGCTATTCCAGCTTGTGG - Intronic
978025379 4:103867325-103867347 GACTTAGCAGTTCCAACCTTAGG - Intergenic
978118478 4:105050151-105050173 AACTCAGCCATTCCAGCCTGTGG + Intergenic
978118527 4:105050416-105050438 TACTCAGCTGGTCCAGCTTATGG + Intergenic
979038065 4:115750767-115750789 GATTCAGCTGTTCCACTCTGAGG - Intergenic
979096972 4:116563231-116563253 TTCTCAGCCGGTCCAGCCTGTGG + Intergenic
979968443 4:127105892-127105914 AACTTAGCCATTCCAGCCTGTGG + Intergenic
979968544 4:127106405-127106427 AACTTAGCTGTTCCAGCCTTGGG + Intergenic
980333671 4:131441125-131441147 AACTCAGCTGTTCCAGTCTGCGG - Intergenic
983431442 4:167656285-167656307 GACTTAGCCATTCCAGCCTTTGG + Intergenic
985043759 4:185918654-185918676 CACTCACCTCTTCCAGCCTAGGG + Intronic
985305884 4:188539072-188539094 GACTCAGCTGTTCCACAATTAGG - Intergenic
985675185 5:1227255-1227277 AACTCAGCTGCTCCACGCTGGGG + Intronic
985775868 5:1841401-1841423 CACCCAGCTGTGCCGGCCTGGGG + Intergenic
986861671 5:11933411-11933433 GCCTCCAATGTTCCAGCCTGTGG + Intergenic
987415980 5:17662783-17662805 ATCTCAGCTGGTCCAGCCTGTGG - Intergenic
987906757 5:24088055-24088077 AACTTAACTGTTCTAGCCTGTGG + Intronic
987906809 5:24088315-24088337 GACTCAACCATTCCAGCCTGTGG + Intronic
989252471 5:39333486-39333508 CACCCAGCTGTTGCAGCTTGAGG + Intronic
989634406 5:43519149-43519171 GCCACAGCTGTCCCAGCCTTCGG + Intergenic
990499680 5:56383859-56383881 GACTTAGCCATTCCAGCCTTTGG - Intergenic
993351361 5:86853753-86853775 GACTTAGCTGTTCCAACCTTTGG - Intergenic
993450710 5:88069729-88069751 GACTTAGCCGTCCCAGCCTTTGG + Intergenic
993792262 5:92222769-92222791 GACTTAGCAGTTCCAGCCTTTGG - Intergenic
993792361 5:92223303-92223325 AGCTTAGCTGTTCCAGCATGTGG - Intergenic
994235323 5:97356087-97356109 GACTCAGCTGTTCCAGTCTTAGG - Intergenic
994551342 5:101238995-101239017 GACTCAGCCATTCCAACTTGTGG - Intergenic
995329762 5:110933792-110933814 AGCTCAGCTGTTCCAGCCTGTGG - Intergenic
995330437 5:110940206-110940228 AACTCAGTTGTTCCAGCCTGTGG - Intergenic
995428574 5:112050068-112050090 GACTCAGTCATTCCAGCCTTTGG + Intergenic
996778594 5:127159682-127159704 ATCTCAGCTTGTCCAGCCTGTGG - Intergenic
996987448 5:129584454-129584476 GACTTAATTGTTCCTGCCTGCGG - Intronic
999480818 5:151946774-151946796 GATTTACCTGCTCCAGCCTGGGG - Intergenic
999666216 5:153916471-153916493 GTCTCAGCTAGTCCAGCCTGTGG - Intergenic
999666371 5:153917244-153917266 GACTAGGCTATTCCAGCTTGTGG - Intergenic
1000031610 5:157406727-157406749 GACTTAGCCATTCCAGCCTTTGG + Intronic
1000509593 5:162165036-162165058 GACTCAGTCGTTCCAGTCTCTGG + Intergenic
1001185766 5:169570283-169570305 GCCTCAGCCACTCCAGCCTGAGG + Intergenic
1001843969 5:174904440-174904462 GACTCAGCTGTTCCAGCCTGTGG + Intergenic
1001844021 5:174904697-174904719 GACTCGGCTGTTCCAGACTGTGG + Intergenic
1002967153 6:1978127-1978149 AACTCAGCTGTTCCAACCTGCGG + Intronic
1004960112 6:20778680-20778702 GTCTCAAGTGTGCCAGCCTGTGG - Intronic
1007195355 6:40055676-40055698 AACTCAACTGTTTCAGCCTGTGG + Intergenic
1007215564 6:40234848-40234870 GACTTAGCCATTCCAGCCTTTGG + Intergenic
1007433041 6:41787383-41787405 GACGGGGCTGTCCCAGCCTGTGG - Intronic
1007478883 6:42137088-42137110 GACTCAGCCATTCCAGTCCGGGG - Intronic
1007980935 6:46157614-46157636 GTCTCTGCTGGTCCTGCCTGAGG + Intergenic
1009325650 6:62345454-62345476 GACTTAGCTGTTACAGGCTTAGG + Intergenic
1009888772 6:69655919-69655941 AGCTTAGCTGTTCCAGCCTTTGG + Intergenic
1010812260 6:80314406-80314428 TTCTCAGCTGGTCCAGCCTGTGG - Intronic
1010812308 6:80314677-80314699 GACTCAGCGGTTCCAGCCTGCGG - Intronic
1010812361 6:80314946-80314968 AACTCAGCCATTCCAGCCCGTGG - Intronic
1011297705 6:85841272-85841294 GACTTAGCTGTTCCAGCCTTTGG + Intergenic
1011507900 6:88068087-88068109 GACTTAGCTGCTCCAGCCTTTGG - Intergenic
1012616334 6:101283618-101283640 GACTTAGCAGTTCCAGGCTTTGG + Intergenic
1012616384 6:101283889-101283911 GACTTAGCGGTTCCAGCCTTTGG + Intergenic
1012630575 6:101461727-101461749 AACTCAGTTTTTTCAGCCTGGGG - Intronic
1014393539 6:120894877-120894899 TAGTCAGCTGGTCCAGCCTGTGG - Intergenic
1015197090 6:130536316-130536338 GACTTAGCCATTCCAGCCTTTGG + Intergenic
1015933887 6:138388964-138388986 TACTCATCTGTTCCTGCATGCGG - Intergenic
1016423748 6:143912824-143912846 TTCTCAGCTTGTCCAGCCTGTGG - Intronic
1016423802 6:143913086-143913108 GACTTAGCTGTTCTGGACTGTGG - Intronic
1016423844 6:143913332-143913354 AATTCAGCTATTCCAGCCTGTGG - Intronic
1016766698 6:147802535-147802557 GACTCAGCAGTTCCACCCCTGGG + Intergenic
1017536077 6:155349298-155349320 GACTCAGCCATTCCAGCCTTTGG - Intergenic
1019036419 6:169063334-169063356 TACTGAGCTGTGCCAGCCTGGGG + Intergenic
1019410564 7:904856-904878 GCCTCAGCTGCCCCACCCTGGGG + Intronic
1019446868 7:1075935-1075957 GACTCTGCTGTTCCTACCTGAGG - Intronic
1019710416 7:2515881-2515903 GAATCAGCTGTGCCACCCTGCGG + Intronic
1019717432 7:2546068-2546090 GACTCAGCGGTGCCTGTCTGAGG + Intronic
1020137844 7:5596462-5596484 CACTCAGCTGACCCAGCCTCTGG - Intronic
1020702250 7:11498536-11498558 GACTTAGCTGTTCCAGCCTTTGG + Intronic
1022076214 7:26973723-26973745 AATTCAGCTGTTCCAGCCTGTGG - Intronic
1022691880 7:32664059-32664081 GCCTCAGCTGCTTCTGCCTGTGG - Intergenic
1022874272 7:34512744-34512766 GATACAGCTCTTTCAGCCTGTGG + Intergenic
1022919542 7:34998600-34998622 GCCTCAGCTGCTTCTGCCTGTGG - Intronic
1024165187 7:46723453-46723475 GGCTCAGCTGTTCTTGCCTTTGG + Intronic
1024334695 7:48195509-48195531 CACTCAGCTGTTCCAGTCAAAGG - Intronic
1025027220 7:55526518-55526540 AAGTCAGCTGTGCCTGCCTGTGG - Intronic
1025818501 7:64942483-64942505 GACTTTGCTGTTCCAGTTTGAGG + Intergenic
1025870004 7:65422593-65422615 AACTCAGCCATTCCAGCCTGTGG + Intergenic
1028082747 7:86598994-86599016 GACTTAGCCGTTCCAGCCTTCGG + Intergenic
1028082837 7:86599596-86599618 GAGACAGCTTTTCCAGCCTTTGG + Intergenic
1028154509 7:87414406-87414428 GACTCAGATATTAGAGCCTGTGG + Intronic
1028961335 7:96752544-96752566 GACTGAGCTTGTCCAACCTGTGG - Intergenic
1028973309 7:96883530-96883552 GATTCTCCTGTTCCAGCCTCTGG - Intergenic
1029346503 7:99982717-99982739 GACTCTTCTGTTTCATCCTGTGG + Intergenic
1029558712 7:101288151-101288173 GACTCTTCTGTTTCATCCTGTGG - Intergenic
1030696212 7:112588178-112588200 GATTCAGCCATTCCAGCCTGCGG + Intergenic
1030809528 7:113956997-113957019 AACTTAGCTGTTCTAGCCTTTGG - Intronic
1031291928 7:119949219-119949241 GACTTAGCAGCTCCAGCCTTGGG + Intergenic
1032562152 7:132903495-132903517 GAGACAGCTCTTCCAGCTTGTGG - Intronic
1033021762 7:137732522-137732544 GACTAAGCTGTGCCAAACTGTGG - Intronic
1033977139 7:147116406-147116428 TTCTCAGCTAGTCCAGCCTGTGG - Intronic
1034256549 7:149727859-149727881 GTCTCTGCCCTTCCAGCCTGTGG + Intronic
1034408570 7:150923554-150923576 GACCCAGCTCTTCCAACCTCTGG - Intergenic
1034870157 7:154676458-154676480 TACACAGGTGTTCCAGGCTGCGG + Intronic
1035296190 7:157868028-157868050 GACTCAGGTGATCCTACCTGCGG - Intronic
1035723273 8:1808996-1809018 GACCCAGGAGTTCCAGGCTGTGG - Intergenic
1035785990 8:2261642-2261664 GAATGAGCTGTTCCAGAATGGGG + Intergenic
1035806817 8:2460074-2460096 GAATGAGCTGTTCCAGAATGGGG - Intergenic
1036201401 8:6774021-6774043 GACTCAGCTGCTACAGCATCAGG - Intergenic
1039380292 8:37078709-37078731 TACTCTTCTGTTCCAGCCTGAGG + Intergenic
1040092006 8:43408447-43408469 GACTCAGCCCTTCAAGCCTGTGG - Intergenic
1040092051 8:43408712-43408734 AACTCAGCCATTCCAGCCTTAGG - Intergenic
1040400632 8:47045952-47045974 GACTCGGCCATTCAAGCCTGGGG + Intergenic
1040400669 8:47046215-47046237 ATCTCAGCTGGTCCAACCTGTGG + Intergenic
1041623374 8:59999097-59999119 GACTCAGCTGTTCCAGCCTGTGG + Intergenic
1041890048 8:62858704-62858726 GACTCAGCTGTTCCAGCCTGTGG - Intronic
1041972627 8:63760928-63760950 GACTCAGCTGTTCCAGCCTGTGG - Intergenic
1041972676 8:63761210-63761232 CACTCAGCCATTCTAGCCTGTGG - Intergenic
1042489454 8:69381218-69381240 GACTCAGCCATTACAGCCTGCGG + Intergenic
1042489513 8:69381491-69381513 AACTCAGCTGTTCCAGCCTGCGG + Intergenic
1043396472 8:79842593-79842615 GATCCAGCCATTCCAGCCTGTGG + Intergenic
1044125815 8:88457140-88457162 AACTTAGCTGTTCCAGTCTTTGG + Intergenic
1044450939 8:92335463-92335485 TTCTCAGCTGGTCCAGCCTATGG - Intergenic
1044451038 8:92335986-92336008 AGCTCAGCAGTTCCAGCTTGTGG - Intergenic
1044451090 8:92336249-92336271 CACTCAGCCATTCCAGCCTGTGG - Intergenic
1046924142 8:119768227-119768249 AACTCAGCTGTTACTGCCTGAGG + Intronic
1049228653 8:141470675-141470697 GTCTCTGCTGTTCCAGAGTGGGG + Intergenic
1049567322 8:143347911-143347933 GACGCAGCTGTAGCAGCCAGGGG + Intronic
1049854351 8:144852307-144852329 TGCTCAGCTCTTCCAGCCCGGGG - Intronic
1050330204 9:4538146-4538168 GACTCACCTGTGACAGCCTCAGG + Intronic
1051334708 9:16055356-16055378 GACCCAGCTCAGCCAGCCTGTGG - Intronic
1052176751 9:25472253-25472275 GACTCAGCCATTTCAGACTGTGG - Intergenic
1052176797 9:25472505-25472527 AACTCAGCCATTCCAGCCTGTGG - Intergenic
1052378304 9:27742083-27742105 GACTTAGCCATTCCAGCCTTTGG - Intergenic
1052626386 9:30981658-30981680 AACTCAGCCATTCCAGCCTTTGG + Intergenic
1053323119 9:37118410-37118432 GTCCCAGCTGTTCCTGGCTGAGG - Intergenic
1055082509 9:72281136-72281158 GCCTCAGCTGCAGCAGCCTGCGG - Intergenic
1055156878 9:73073822-73073844 GACTCAGCGGTTCCAGTCTTAGG - Intronic
1056127969 9:83555204-83555226 GACTTAGCCATTCCAGCCTTTGG - Intergenic
1056907461 9:90665959-90665981 GACTTAGCCATTCCAGCCTTTGG - Intergenic
1057205103 9:93167119-93167141 TCCTCAGCTGTTCCTGCCTGGGG - Intergenic
1057953197 9:99386154-99386176 GAGTCAGCGGTTGGAGCCTGGGG - Intergenic
1058200172 9:102028738-102028760 AACTCAGCCGTTTCAGCCTGTGG - Intergenic
1058408514 9:104704041-104704063 GACTTAAATGTTCCTGCCTGTGG + Intergenic
1062391941 9:136337365-136337387 TACTCAGCTCTTCTAGCCTGGGG + Intronic
1062709328 9:137965279-137965301 TTCTCAGCCATTCCAGCCTGTGG - Intronic
1186593227 X:10953239-10953261 GACTCAGCCATTCCAGCCTGTGG + Intergenic
1186593279 X:10953505-10953527 GTCTCAGCCAGTCCAGCCTGTGG + Intergenic
1187038645 X:15569399-15569421 GTCTCAGATGATCCAGTCTGAGG - Intronic
1188714845 X:33448687-33448709 GACTTAGCCATTCCAGCCTTTGG + Intergenic
1188901101 X:35733862-35733884 GACTCAGCCATTCCAGCCTATGG - Intergenic
1188901146 X:35734131-35734153 GACACAGCAGTTCCAGTCTGCGG - Intergenic
1189075084 X:37906109-37906131 GAGGCAGCTGGTCCAGCCTCAGG - Intronic
1189581666 X:42413676-42413698 TTCTCAGCTGGTCCAGCCTGTGG - Intergenic
1189854913 X:45214452-45214474 GACTCAGCCATTCCAGCCTGTGG + Intergenic
1190133097 X:47768878-47768900 GACTTAGCTGTTCCAGCCTTCGG + Intergenic
1190600643 X:52089009-52089031 AACTTAGCAGTTCCAGCCTTTGG - Intergenic
1190803569 X:53814159-53814181 GACTCAGCTGTTCCAGCCTGTGG - Intergenic
1191209647 X:57871647-57871669 GACTCAGCAGTTCCAGCCTGTGG - Intergenic
1191209695 X:57871915-57871937 GACTCAACTGTTCCAGCCTGCGG - Intergenic
1191703068 X:64064108-64064130 GACTCAGCCCTTCCAGCCTGAGG + Intergenic
1191739030 X:64417609-64417631 GACTTAGCTGTTTCAGTCTTTGG - Intergenic
1191876914 X:65806903-65806925 AACTCAGCCATTCCAGCATGTGG + Intergenic
1191930311 X:66365077-66365099 GATTCAGCTGTTCCAGCCTGCGG - Intergenic
1192011384 X:67277302-67277324 GACTTAGCTTTTCCAGTCTTTGG + Intergenic
1192343736 X:70284259-70284281 CACACAGCTGTTCCGGCGTGTGG + Exonic
1192718740 X:73669724-73669746 GACTCAGCTGTTCTAGCCTGTGG - Intronic
1192723465 X:73724321-73724343 AACTCAGCCATTCTAGCCTGTGG - Intergenic
1192723507 X:73724549-73724571 GACTCAGGCGTTCCAGCCTGTGG - Intergenic
1192920419 X:75700345-75700367 GACTCAGCTGTTCTAGACTGTGG + Intergenic
1192920468 X:75700620-75700642 GACCCAGCCATTCCAGCTTGTGG + Intergenic
1192923646 X:75734114-75734136 GCCTTAGCTGTTCTTGCCTGTGG - Intergenic
1192950322 X:76009729-76009751 AACTCAGCCATTCTAGCCTGTGG - Intergenic
1193301274 X:79891808-79891830 GACTCAGCCATTCCAGCCTGTGG + Intergenic
1193712171 X:84893672-84893694 AACTTAGCCGTTCCAGCCTTTGG - Intergenic
1193712370 X:84894757-84894779 AACTTAGCTATTCCAGTCTGTGG - Intergenic
1193715060 X:84927625-84927647 AACTTAGCTGTTTCAGCCTTTGG - Intergenic
1193739774 X:85203401-85203423 GACTTAGCCATTCCAGCCTTTGG - Intergenic
1193739781 X:85203450-85203472 GACTTAGCCATTCCAGCCTTTGG - Intergenic
1193758797 X:85440647-85440669 GACTCAGCAGCTCCAGTCTATGG - Intergenic
1193758844 X:85440908-85440930 GACTTAGCCATTCCAGCCTGTGG - Intergenic
1193762881 X:85489090-85489112 GACTCAACCATTCCAGCCTGTGG - Intergenic
1193933030 X:87581008-87581030 AACTCATCCATTCCAGCCTGTGG + Intronic
1194029168 X:88789965-88789987 GACTCAGCCATTCCAGCCTGTGG - Intergenic
1194067914 X:89284665-89284687 GAGACAGCCGTTCCACCCTGTGG - Intergenic
1194537168 X:95119502-95119524 GACTCAGCTATTCCAACCTGTGG - Intergenic
1194594042 X:95836223-95836245 GACTTAGCTGTTTCAGCCTTTGG - Intergenic
1194594180 X:95837029-95837051 GACTTAGCCATTCCAGCCTTTGG - Intergenic
1194608053 X:96005971-96005993 GACTCAGCCATTCCAGCCTGTGG + Intergenic
1194608109 X:96006239-96006261 GACTCAGCCACTGCAGCCTGTGG + Intergenic
1194635670 X:96342824-96342846 GACTTAGCCATTCCAGTCTGTGG - Intergenic
1194854757 X:98915323-98915345 GACTTAGCTGTTTCAGCCTTTGG - Intergenic
1194867434 X:99086185-99086207 GACTTAGCAGTTCCAGCCTTTGG + Intergenic
1194953420 X:100153147-100153169 GACTCAACTGTTCAATCTTGTGG - Intergenic
1194953532 X:100153707-100153729 AACTCAACTGTTCCTGCCTGTGG - Intergenic
1195104870 X:101593963-101593985 GACTTAGCCATTCCAGCCTGTGG - Intergenic
1195346234 X:103953580-103953602 GACTTAGCCCTTCCAGCCTTTGG + Intronic
1195866592 X:109439125-109439147 GACTCAGCTGGTCCAAGGTGTGG - Intronic
1195966991 X:110437873-110437895 GACTCAGGTAATTCAGCCTGAGG + Intronic
1196152784 X:112392913-112392935 GACCTAGCTCTTCCAGCCTTTGG - Intergenic
1196228121 X:113189669-113189691 GACTTAGCCATTCCAGCCTTTGG - Intergenic
1196241430 X:113346814-113346836 AACTTAGCTGTTCCAGCCTTCGG - Intergenic
1196500535 X:116376000-116376022 GACTCAGCTTTGCTACCCTGGGG + Intergenic
1196582088 X:117391248-117391270 GACTTAGATATTCCAGCCTTGGG + Intergenic
1196820123 X:119694549-119694571 TCCTCAGCTGCTCCAGCCTTGGG - Intergenic
1196932538 X:120695954-120695976 GACTTAGCCATTCCAGCCTTTGG + Intergenic
1197077049 X:122364723-122364745 AACTTAGCTCTTCCAGCCTTCGG - Intergenic
1198786322 X:140292287-140292309 AACTCAGCCTTTTCAGCCTGTGG - Intergenic
1199248898 X:145637451-145637473 GACTTAGCTGTTTCAGCCTTTGG + Intergenic
1199307218 X:146280300-146280322 AACTTAGCTGTTCCAGCCTTTGG - Intergenic
1199393996 X:147312573-147312595 GACTTAGCTGTTCTAGCCTTTGG + Intergenic
1199478649 X:148273808-148273830 AACTTAGATATTCCAGCCTGTGG + Intergenic
1199589236 X:149451094-149451116 TTCTCAGCTGCTCCAACCTGTGG - Intergenic
1200344958 X:155439114-155439136 AACTAAGCTTTTCCAGCCAGAGG - Intergenic
1200721964 Y:6618296-6618318 GACTTAGCTATTCCGGCCTTTGG - Intergenic
1200722058 Y:6618826-6618848 GAGACAGCCGTTCCACCCTGTGG - Intergenic
1201936007 Y:19411595-19411617 GGCTCAGGTATTCCAGCCTGTGG + Intergenic