ID: 1001845255

View in Genome Browser
Species Human (GRCh38)
Location 5:174916445-174916467
Sequence AGGGAGAATGCAGCAACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001845246_1001845255 26 Left 1001845246 5:174916396-174916418 CCCAGCAGGGGCGGCTGTGGTGC No data
Right 1001845255 5:174916445-174916467 AGGGAGAATGCAGCAACTGTGGG No data
1001845247_1001845255 25 Left 1001845247 5:174916397-174916419 CCAGCAGGGGCGGCTGTGGTGCT No data
Right 1001845255 5:174916445-174916467 AGGGAGAATGCAGCAACTGTGGG No data
1001845245_1001845255 27 Left 1001845245 5:174916395-174916417 CCCCAGCAGGGGCGGCTGTGGTG No data
Right 1001845255 5:174916445-174916467 AGGGAGAATGCAGCAACTGTGGG No data
1001845244_1001845255 28 Left 1001845244 5:174916394-174916416 CCCCCAGCAGGGGCGGCTGTGGT No data
Right 1001845255 5:174916445-174916467 AGGGAGAATGCAGCAACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001845255 Original CRISPR AGGGAGAATGCAGCAACTGT GGG Intergenic
No off target data available for this crispr