ID: 1001847945

View in Genome Browser
Species Human (GRCh38)
Location 5:174938079-174938101
Sequence GGGATTGTCCCCTGTGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001847945_1001847950 8 Left 1001847945 5:174938079-174938101 CCCAGGCCACAGGGGACAATCCC No data
Right 1001847950 5:174938110-174938132 AACAGTCACTCTCAAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001847945 Original CRISPR GGGATTGTCCCCTGTGGCCT GGG (reversed) Intergenic