ID: 1001848336

View in Genome Browser
Species Human (GRCh38)
Location 5:174941036-174941058
Sequence AAGTGATGGGAGGAGTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001848327_1001848336 22 Left 1001848327 5:174940991-174941013 CCCGTGTGAAGTTGCTGAACACA No data
Right 1001848336 5:174941036-174941058 AAGTGATGGGAGGAGTCTGGAGG No data
1001848328_1001848336 21 Left 1001848328 5:174940992-174941014 CCGTGTGAAGTTGCTGAACACAG No data
Right 1001848336 5:174941036-174941058 AAGTGATGGGAGGAGTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001848336 Original CRISPR AAGTGATGGGAGGAGTCTGG AGG Intergenic
No off target data available for this crispr