ID: 1001852783

View in Genome Browser
Species Human (GRCh38)
Location 5:174984123-174984145
Sequence TTGTAAAGAAGCAGCATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001852783_1001852785 -2 Left 1001852783 5:174984123-174984145 CCTACAATGCTGCTTCTTTACAA No data
Right 1001852785 5:174984144-174984166 AAAGCTGCTTAATTTTCCAAGGG No data
1001852783_1001852786 -1 Left 1001852783 5:174984123-174984145 CCTACAATGCTGCTTCTTTACAA No data
Right 1001852786 5:174984145-174984167 AAGCTGCTTAATTTTCCAAGGGG No data
1001852783_1001852784 -3 Left 1001852783 5:174984123-174984145 CCTACAATGCTGCTTCTTTACAA No data
Right 1001852784 5:174984143-174984165 CAAAGCTGCTTAATTTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001852783 Original CRISPR TTGTAAAGAAGCAGCATTGT AGG (reversed) Intergenic
No off target data available for this crispr