ID: 1001859384 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:175040142-175040164 |
| Sequence | GCTGCTATTAAGTTGAAAGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1001859384_1001859388 | -1 | Left | 1001859384 | 5:175040142-175040164 | CCCTCTTTCAACTTAATAGCAGC | No data | ||
| Right | 1001859388 | 5:175040164-175040186 | CTACTGAGGTCTTCAAGCTTGGG | No data | ||||
| 1001859384_1001859387 | -2 | Left | 1001859384 | 5:175040142-175040164 | CCCTCTTTCAACTTAATAGCAGC | No data | ||
| Right | 1001859387 | 5:175040163-175040185 | GCTACTGAGGTCTTCAAGCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1001859384 | Original CRISPR | GCTGCTATTAAGTTGAAAGA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||