ID: 1001859384

View in Genome Browser
Species Human (GRCh38)
Location 5:175040142-175040164
Sequence GCTGCTATTAAGTTGAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001859384_1001859388 -1 Left 1001859384 5:175040142-175040164 CCCTCTTTCAACTTAATAGCAGC No data
Right 1001859388 5:175040164-175040186 CTACTGAGGTCTTCAAGCTTGGG No data
1001859384_1001859387 -2 Left 1001859384 5:175040142-175040164 CCCTCTTTCAACTTAATAGCAGC No data
Right 1001859387 5:175040163-175040185 GCTACTGAGGTCTTCAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001859384 Original CRISPR GCTGCTATTAAGTTGAAAGA GGG (reversed) Intergenic
No off target data available for this crispr