ID: 1001860810

View in Genome Browser
Species Human (GRCh38)
Location 5:175053182-175053204
Sequence ACTGTGTAGGGACCTCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001860810_1001860815 7 Left 1001860810 5:175053182-175053204 CCTGCTTGAGGTCCCTACACAGT No data
Right 1001860815 5:175053212-175053234 CTGCAGTGTATCCCATCTCCTGG No data
1001860810_1001860816 8 Left 1001860810 5:175053182-175053204 CCTGCTTGAGGTCCCTACACAGT No data
Right 1001860816 5:175053213-175053235 TGCAGTGTATCCCATCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001860810 Original CRISPR ACTGTGTAGGGACCTCAAGC AGG (reversed) Intergenic