ID: 1001865760

View in Genome Browser
Species Human (GRCh38)
Location 5:175103990-175104012
Sequence AAGCCTGCTAGCACCAACAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001865760_1001865762 16 Left 1001865760 5:175103990-175104012 CCGTTGTTGGTGCTAGCAGGCTT No data
Right 1001865762 5:175104029-175104051 TTTTTTTCCATAGTCTAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001865760 Original CRISPR AAGCCTGCTAGCACCAACAA CGG (reversed) Intergenic
No off target data available for this crispr