ID: 1001868714

View in Genome Browser
Species Human (GRCh38)
Location 5:175131349-175131371
Sequence GGCCTCAAGGGAGTGAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001868714_1001868721 -8 Left 1001868714 5:175131349-175131371 CCCCTCCTCACTCCCTTGAGGCC No data
Right 1001868721 5:175131364-175131386 TTGAGGCCCTGCCACAAGATGGG No data
1001868714_1001868729 28 Left 1001868714 5:175131349-175131371 CCCCTCCTCACTCCCTTGAGGCC No data
Right 1001868729 5:175131400-175131422 CAGATCTTCCGATGGGTGGGAGG No data
1001868714_1001868725 20 Left 1001868714 5:175131349-175131371 CCCCTCCTCACTCCCTTGAGGCC No data
Right 1001868725 5:175131392-175131414 GTGACAATCAGATCTTCCGATGG No data
1001868714_1001868728 25 Left 1001868714 5:175131349-175131371 CCCCTCCTCACTCCCTTGAGGCC No data
Right 1001868728 5:175131397-175131419 AATCAGATCTTCCGATGGGTGGG No data
1001868714_1001868726 21 Left 1001868714 5:175131349-175131371 CCCCTCCTCACTCCCTTGAGGCC No data
Right 1001868726 5:175131393-175131415 TGACAATCAGATCTTCCGATGGG No data
1001868714_1001868720 -9 Left 1001868714 5:175131349-175131371 CCCCTCCTCACTCCCTTGAGGCC No data
Right 1001868720 5:175131363-175131385 CTTGAGGCCCTGCCACAAGATGG No data
1001868714_1001868727 24 Left 1001868714 5:175131349-175131371 CCCCTCCTCACTCCCTTGAGGCC No data
Right 1001868727 5:175131396-175131418 CAATCAGATCTTCCGATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001868714 Original CRISPR GGCCTCAAGGGAGTGAGGAG GGG (reversed) Intergenic