ID: 1001870644

View in Genome Browser
Species Human (GRCh38)
Location 5:175151329-175151351
Sequence TCTGACATGCAGCTGGTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001870635_1001870644 30 Left 1001870635 5:175151276-175151298 CCTCTTTCACTGTTGGTGAAGCT No data
Right 1001870644 5:175151329-175151351 TCTGACATGCAGCTGGTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001870644 Original CRISPR TCTGACATGCAGCTGGTCAA TGG Intergenic
No off target data available for this crispr