ID: 1001872079

View in Genome Browser
Species Human (GRCh38)
Location 5:175165301-175165323
Sequence CTGCCCTTGCACCCACCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001872079_1001872085 28 Left 1001872079 5:175165301-175165323 CCATTGGGTGGGTGCAAGGGCAG No data
Right 1001872085 5:175165352-175165374 GAGACACCCATGTTTGCTGTGGG No data
1001872079_1001872082 -6 Left 1001872079 5:175165301-175165323 CCATTGGGTGGGTGCAAGGGCAG No data
Right 1001872082 5:175165318-175165340 GGGCAGTAGATGGAAGCCTAGGG No data
1001872079_1001872084 27 Left 1001872079 5:175165301-175165323 CCATTGGGTGGGTGCAAGGGCAG No data
Right 1001872084 5:175165351-175165373 AGAGACACCCATGTTTGCTGTGG No data
1001872079_1001872081 -7 Left 1001872079 5:175165301-175165323 CCATTGGGTGGGTGCAAGGGCAG No data
Right 1001872081 5:175165317-175165339 AGGGCAGTAGATGGAAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001872079 Original CRISPR CTGCCCTTGCACCCACCCAA TGG (reversed) Intergenic