ID: 1001872083

View in Genome Browser
Species Human (GRCh38)
Location 5:175165334-175165356
Sequence GTCTCTTGCAAAGACACCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001872083_1001872084 -6 Left 1001872083 5:175165334-175165356 CCTAGGGTGTCTTTGCAAGAGAC No data
Right 1001872084 5:175165351-175165373 AGAGACACCCATGTTTGCTGTGG No data
1001872083_1001872088 14 Left 1001872083 5:175165334-175165356 CCTAGGGTGTCTTTGCAAGAGAC No data
Right 1001872088 5:175165371-175165393 TGGGCAGAACTAGTGCAAAATGG No data
1001872083_1001872089 15 Left 1001872083 5:175165334-175165356 CCTAGGGTGTCTTTGCAAGAGAC No data
Right 1001872089 5:175165372-175165394 GGGCAGAACTAGTGCAAAATGGG No data
1001872083_1001872085 -5 Left 1001872083 5:175165334-175165356 CCTAGGGTGTCTTTGCAAGAGAC No data
Right 1001872085 5:175165352-175165374 GAGACACCCATGTTTGCTGTGGG No data
1001872083_1001872090 16 Left 1001872083 5:175165334-175165356 CCTAGGGTGTCTTTGCAAGAGAC No data
Right 1001872090 5:175165373-175165395 GGCAGAACTAGTGCAAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001872083 Original CRISPR GTCTCTTGCAAAGACACCCT AGG (reversed) Intergenic
No off target data available for this crispr