ID: 1001872084

View in Genome Browser
Species Human (GRCh38)
Location 5:175165351-175165373
Sequence AGAGACACCCATGTTTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001872079_1001872084 27 Left 1001872079 5:175165301-175165323 CCATTGGGTGGGTGCAAGGGCAG No data
Right 1001872084 5:175165351-175165373 AGAGACACCCATGTTTGCTGTGG No data
1001872083_1001872084 -6 Left 1001872083 5:175165334-175165356 CCTAGGGTGTCTTTGCAAGAGAC No data
Right 1001872084 5:175165351-175165373 AGAGACACCCATGTTTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001872084 Original CRISPR AGAGACACCCATGTTTGCTG TGG Intergenic