ID: 1001872085 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:175165352-175165374 |
Sequence | GAGACACCCATGTTTGCTGT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1001872083_1001872085 | -5 | Left | 1001872083 | 5:175165334-175165356 | CCTAGGGTGTCTTTGCAAGAGAC | No data | ||
Right | 1001872085 | 5:175165352-175165374 | GAGACACCCATGTTTGCTGTGGG | No data | ||||
1001872079_1001872085 | 28 | Left | 1001872079 | 5:175165301-175165323 | CCATTGGGTGGGTGCAAGGGCAG | No data | ||
Right | 1001872085 | 5:175165352-175165374 | GAGACACCCATGTTTGCTGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1001872085 | Original CRISPR | GAGACACCCATGTTTGCTGT GGG | Intergenic | ||