ID: 1001872086

View in Genome Browser
Species Human (GRCh38)
Location 5:175165358-175165380
Sequence GTTCTGCCCACAGCAAACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001872086_1001872088 -10 Left 1001872086 5:175165358-175165380 CCCATGTTTGCTGTGGGCAGAAC No data
Right 1001872088 5:175165371-175165393 TGGGCAGAACTAGTGCAAAATGG No data
1001872086_1001872090 -8 Left 1001872086 5:175165358-175165380 CCCATGTTTGCTGTGGGCAGAAC No data
Right 1001872090 5:175165373-175165395 GGCAGAACTAGTGCAAAATGGGG No data
1001872086_1001872092 16 Left 1001872086 5:175165358-175165380 CCCATGTTTGCTGTGGGCAGAAC No data
Right 1001872092 5:175165397-175165419 GAATCAGAGCTCGGCTATCATGG No data
1001872086_1001872091 7 Left 1001872086 5:175165358-175165380 CCCATGTTTGCTGTGGGCAGAAC No data
Right 1001872091 5:175165388-175165410 AAATGGGGAGAATCAGAGCTCGG No data
1001872086_1001872089 -9 Left 1001872086 5:175165358-175165380 CCCATGTTTGCTGTGGGCAGAAC No data
Right 1001872089 5:175165372-175165394 GGGCAGAACTAGTGCAAAATGGG No data
1001872086_1001872094 18 Left 1001872086 5:175165358-175165380 CCCATGTTTGCTGTGGGCAGAAC No data
Right 1001872094 5:175165399-175165421 ATCAGAGCTCGGCTATCATGGGG No data
1001872086_1001872093 17 Left 1001872086 5:175165358-175165380 CCCATGTTTGCTGTGGGCAGAAC No data
Right 1001872093 5:175165398-175165420 AATCAGAGCTCGGCTATCATGGG No data
1001872086_1001872095 23 Left 1001872086 5:175165358-175165380 CCCATGTTTGCTGTGGGCAGAAC No data
Right 1001872095 5:175165404-175165426 AGCTCGGCTATCATGGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001872086 Original CRISPR GTTCTGCCCACAGCAAACAT GGG (reversed) Intergenic