ID: 1001872087

View in Genome Browser
Species Human (GRCh38)
Location 5:175165359-175165381
Sequence AGTTCTGCCCACAGCAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001872087_1001872089 -10 Left 1001872087 5:175165359-175165381 CCATGTTTGCTGTGGGCAGAACT No data
Right 1001872089 5:175165372-175165394 GGGCAGAACTAGTGCAAAATGGG No data
1001872087_1001872092 15 Left 1001872087 5:175165359-175165381 CCATGTTTGCTGTGGGCAGAACT No data
Right 1001872092 5:175165397-175165419 GAATCAGAGCTCGGCTATCATGG No data
1001872087_1001872093 16 Left 1001872087 5:175165359-175165381 CCATGTTTGCTGTGGGCAGAACT No data
Right 1001872093 5:175165398-175165420 AATCAGAGCTCGGCTATCATGGG No data
1001872087_1001872090 -9 Left 1001872087 5:175165359-175165381 CCATGTTTGCTGTGGGCAGAACT No data
Right 1001872090 5:175165373-175165395 GGCAGAACTAGTGCAAAATGGGG No data
1001872087_1001872095 22 Left 1001872087 5:175165359-175165381 CCATGTTTGCTGTGGGCAGAACT No data
Right 1001872095 5:175165404-175165426 AGCTCGGCTATCATGGGGTTTGG No data
1001872087_1001872091 6 Left 1001872087 5:175165359-175165381 CCATGTTTGCTGTGGGCAGAACT No data
Right 1001872091 5:175165388-175165410 AAATGGGGAGAATCAGAGCTCGG No data
1001872087_1001872094 17 Left 1001872087 5:175165359-175165381 CCATGTTTGCTGTGGGCAGAACT No data
Right 1001872094 5:175165399-175165421 ATCAGAGCTCGGCTATCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001872087 Original CRISPR AGTTCTGCCCACAGCAAACA TGG (reversed) Intergenic
No off target data available for this crispr