ID: 1001872088

View in Genome Browser
Species Human (GRCh38)
Location 5:175165371-175165393
Sequence TGGGCAGAACTAGTGCAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001872086_1001872088 -10 Left 1001872086 5:175165358-175165380 CCCATGTTTGCTGTGGGCAGAAC No data
Right 1001872088 5:175165371-175165393 TGGGCAGAACTAGTGCAAAATGG No data
1001872083_1001872088 14 Left 1001872083 5:175165334-175165356 CCTAGGGTGTCTTTGCAAGAGAC No data
Right 1001872088 5:175165371-175165393 TGGGCAGAACTAGTGCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001872088 Original CRISPR TGGGCAGAACTAGTGCAAAA TGG Intergenic