ID: 1001872089

View in Genome Browser
Species Human (GRCh38)
Location 5:175165372-175165394
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001872086_1001872089 -9 Left 1001872086 5:175165358-175165380 CCCATGTTTGCTGTGGGCAGAAC No data
Right 1001872089 5:175165372-175165394 GGGCAGAACTAGTGCAAAATGGG No data
1001872083_1001872089 15 Left 1001872083 5:175165334-175165356 CCTAGGGTGTCTTTGCAAGAGAC No data
Right 1001872089 5:175165372-175165394 GGGCAGAACTAGTGCAAAATGGG No data
1001872087_1001872089 -10 Left 1001872087 5:175165359-175165381 CCATGTTTGCTGTGGGCAGAACT No data
Right 1001872089 5:175165372-175165394 GGGCAGAACTAGTGCAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001872089 Original CRISPR GGGCAGAACTAGTGCAAAAT GGG Intergenic