ID: 1001872090

View in Genome Browser
Species Human (GRCh38)
Location 5:175165373-175165395
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001872087_1001872090 -9 Left 1001872087 5:175165359-175165381 CCATGTTTGCTGTGGGCAGAACT No data
Right 1001872090 5:175165373-175165395 GGCAGAACTAGTGCAAAATGGGG No data
1001872083_1001872090 16 Left 1001872083 5:175165334-175165356 CCTAGGGTGTCTTTGCAAGAGAC No data
Right 1001872090 5:175165373-175165395 GGCAGAACTAGTGCAAAATGGGG No data
1001872086_1001872090 -8 Left 1001872086 5:175165358-175165380 CCCATGTTTGCTGTGGGCAGAAC No data
Right 1001872090 5:175165373-175165395 GGCAGAACTAGTGCAAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001872090 Original CRISPR GGCAGAACTAGTGCAAAATG GGG Intergenic