ID: 1001877247

View in Genome Browser
Species Human (GRCh38)
Location 5:175212404-175212426
Sequence CATGATCTCCTCCAAGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001877247_1001877255 30 Left 1001877247 5:175212404-175212426 CCTGCTCCTTGGAGGAGATCATG No data
Right 1001877255 5:175212457-175212479 AACTTCCCACTAAGTTGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001877247 Original CRISPR CATGATCTCCTCCAAGGAGC AGG (reversed) Intergenic
No off target data available for this crispr