ID: 1001879907

View in Genome Browser
Species Human (GRCh38)
Location 5:175234361-175234383
Sequence TAGGATCCTGAAGGTGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001879907_1001879915 21 Left 1001879907 5:175234361-175234383 CCCTTCCCACCTTCAGGATCCTA No data
Right 1001879915 5:175234405-175234427 GACAGTGATGTTTTAGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001879907 Original CRISPR TAGGATCCTGAAGGTGGGAA GGG (reversed) Intergenic
No off target data available for this crispr