ID: 1001880288

View in Genome Browser
Species Human (GRCh38)
Location 5:175237723-175237745
Sequence ATAAGCCTTCTGCCCATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001880288_1001880290 -7 Left 1001880288 5:175237723-175237745 CCTAAAATGGGCAGAAGGCTTAT No data
Right 1001880290 5:175237739-175237761 GGCTTATCTCTTAAGGTTATAGG No data
1001880288_1001880291 -6 Left 1001880288 5:175237723-175237745 CCTAAAATGGGCAGAAGGCTTAT No data
Right 1001880291 5:175237740-175237762 GCTTATCTCTTAAGGTTATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001880288 Original CRISPR ATAAGCCTTCTGCCCATTTT AGG (reversed) Intergenic
No off target data available for this crispr