ID: 1001881431

View in Genome Browser
Species Human (GRCh38)
Location 5:175247857-175247879
Sequence TGGACATGGACCATTCCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001881431_1001881439 17 Left 1001881431 5:175247857-175247879 CCCAAAGGAATGGTCCATGTCCA No data
Right 1001881439 5:175247897-175247919 GGAAACATATGACTGCAATGTGG No data
1001881431_1001881435 -4 Left 1001881431 5:175247857-175247879 CCCAAAGGAATGGTCCATGTCCA No data
Right 1001881435 5:175247876-175247898 TCCAGAGGAACTCTTAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001881431 Original CRISPR TGGACATGGACCATTCCTTT GGG (reversed) Intergenic
No off target data available for this crispr