ID: 1001887574

View in Genome Browser
Species Human (GRCh38)
Location 5:175309284-175309306
Sequence CAGTGAAAGGGCAAGGTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001887574_1001887580 -9 Left 1001887574 5:175309284-175309306 CCAGATACCTTGCCCTTTCACTG No data
Right 1001887580 5:175309298-175309320 CTTTCACTGAGATGACTCTGGGG No data
1001887574_1001887579 -10 Left 1001887574 5:175309284-175309306 CCAGATACCTTGCCCTTTCACTG No data
Right 1001887579 5:175309297-175309319 CCTTTCACTGAGATGACTCTGGG No data
1001887574_1001887582 16 Left 1001887574 5:175309284-175309306 CCAGATACCTTGCCCTTTCACTG No data
Right 1001887582 5:175309323-175309345 TGTTTTACAGTCTCTCAGGCTGG No data
1001887574_1001887581 12 Left 1001887574 5:175309284-175309306 CCAGATACCTTGCCCTTTCACTG No data
Right 1001887581 5:175309319-175309341 GGCATGTTTTACAGTCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001887574 Original CRISPR CAGTGAAAGGGCAAGGTATC TGG (reversed) Intergenic
No off target data available for this crispr