ID: 1001889823

View in Genome Browser
Species Human (GRCh38)
Location 5:175329502-175329524
Sequence GAGTTGACCATTGGAGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001889823_1001889828 10 Left 1001889823 5:175329502-175329524 CCAGAAACTCCAATGGTCAACTC No data
Right 1001889828 5:175329535-175329557 CCCACGGCTCCTCTATGCAGAGG No data
1001889823_1001889825 -6 Left 1001889823 5:175329502-175329524 CCAGAAACTCCAATGGTCAACTC No data
Right 1001889825 5:175329519-175329541 CAACTCCTTCATGCAGCCCACGG No data
1001889823_1001889832 27 Left 1001889823 5:175329502-175329524 CCAGAAACTCCAATGGTCAACTC No data
Right 1001889832 5:175329552-175329574 CAGAGGAAACTGTAGTGTTTGGG No data
1001889823_1001889831 26 Left 1001889823 5:175329502-175329524 CCAGAAACTCCAATGGTCAACTC No data
Right 1001889831 5:175329551-175329573 GCAGAGGAAACTGTAGTGTTTGG No data
1001889823_1001889833 28 Left 1001889823 5:175329502-175329524 CCAGAAACTCCAATGGTCAACTC No data
Right 1001889833 5:175329553-175329575 AGAGGAAACTGTAGTGTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001889823 Original CRISPR GAGTTGACCATTGGAGTTTC TGG (reversed) Intergenic