ID: 1001889824

View in Genome Browser
Species Human (GRCh38)
Location 5:175329511-175329533
Sequence TGCATGAAGGAGTTGACCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001889824_1001889832 18 Left 1001889824 5:175329511-175329533 CCAATGGTCAACTCCTTCATGCA No data
Right 1001889832 5:175329552-175329574 CAGAGGAAACTGTAGTGTTTGGG No data
1001889824_1001889833 19 Left 1001889824 5:175329511-175329533 CCAATGGTCAACTCCTTCATGCA No data
Right 1001889833 5:175329553-175329575 AGAGGAAACTGTAGTGTTTGGGG No data
1001889824_1001889831 17 Left 1001889824 5:175329511-175329533 CCAATGGTCAACTCCTTCATGCA No data
Right 1001889831 5:175329551-175329573 GCAGAGGAAACTGTAGTGTTTGG No data
1001889824_1001889828 1 Left 1001889824 5:175329511-175329533 CCAATGGTCAACTCCTTCATGCA No data
Right 1001889828 5:175329535-175329557 CCCACGGCTCCTCTATGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001889824 Original CRISPR TGCATGAAGGAGTTGACCAT TGG (reversed) Intergenic
No off target data available for this crispr