ID: 1001889825

View in Genome Browser
Species Human (GRCh38)
Location 5:175329519-175329541
Sequence CAACTCCTTCATGCAGCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001889815_1001889825 28 Left 1001889815 5:175329468-175329490 CCCTCAGGCAGTGGAGAACCCAG No data
Right 1001889825 5:175329519-175329541 CAACTCCTTCATGCAGCCCACGG No data
1001889820_1001889825 10 Left 1001889820 5:175329486-175329508 CCCAGTGGGGTCAGAGCCAGAAA No data
Right 1001889825 5:175329519-175329541 CAACTCCTTCATGCAGCCCACGG No data
1001889823_1001889825 -6 Left 1001889823 5:175329502-175329524 CCAGAAACTCCAATGGTCAACTC No data
Right 1001889825 5:175329519-175329541 CAACTCCTTCATGCAGCCCACGG No data
1001889821_1001889825 9 Left 1001889821 5:175329487-175329509 CCAGTGGGGTCAGAGCCAGAAAC No data
Right 1001889825 5:175329519-175329541 CAACTCCTTCATGCAGCCCACGG No data
1001889816_1001889825 27 Left 1001889816 5:175329469-175329491 CCTCAGGCAGTGGAGAACCCAGT No data
Right 1001889825 5:175329519-175329541 CAACTCCTTCATGCAGCCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001889825 Original CRISPR CAACTCCTTCATGCAGCCCA CGG Intergenic
No off target data available for this crispr