ID: 1001889827

View in Genome Browser
Species Human (GRCh38)
Location 5:175329535-175329557
Sequence CCTCTGCATAGAGGAGCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001889827_1001889831 -7 Left 1001889827 5:175329535-175329557 CCCACGGCTCCTCTATGCAGAGG No data
Right 1001889831 5:175329551-175329573 GCAGAGGAAACTGTAGTGTTTGG No data
1001889827_1001889833 -5 Left 1001889827 5:175329535-175329557 CCCACGGCTCCTCTATGCAGAGG No data
Right 1001889833 5:175329553-175329575 AGAGGAAACTGTAGTGTTTGGGG No data
1001889827_1001889832 -6 Left 1001889827 5:175329535-175329557 CCCACGGCTCCTCTATGCAGAGG No data
Right 1001889832 5:175329552-175329574 CAGAGGAAACTGTAGTGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001889827 Original CRISPR CCTCTGCATAGAGGAGCCGT GGG (reversed) Intergenic
No off target data available for this crispr