ID: 1001889828

View in Genome Browser
Species Human (GRCh38)
Location 5:175329535-175329557
Sequence CCCACGGCTCCTCTATGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001889820_1001889828 26 Left 1001889820 5:175329486-175329508 CCCAGTGGGGTCAGAGCCAGAAA No data
Right 1001889828 5:175329535-175329557 CCCACGGCTCCTCTATGCAGAGG No data
1001889821_1001889828 25 Left 1001889821 5:175329487-175329509 CCAGTGGGGTCAGAGCCAGAAAC No data
Right 1001889828 5:175329535-175329557 CCCACGGCTCCTCTATGCAGAGG No data
1001889823_1001889828 10 Left 1001889823 5:175329502-175329524 CCAGAAACTCCAATGGTCAACTC No data
Right 1001889828 5:175329535-175329557 CCCACGGCTCCTCTATGCAGAGG No data
1001889824_1001889828 1 Left 1001889824 5:175329511-175329533 CCAATGGTCAACTCCTTCATGCA No data
Right 1001889828 5:175329535-175329557 CCCACGGCTCCTCTATGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001889828 Original CRISPR CCCACGGCTCCTCTATGCAG AGG Intergenic
No off target data available for this crispr