ID: 1001889833

View in Genome Browser
Species Human (GRCh38)
Location 5:175329553-175329575
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001889823_1001889833 28 Left 1001889823 5:175329502-175329524 CCAGAAACTCCAATGGTCAACTC No data
Right 1001889833 5:175329553-175329575 AGAGGAAACTGTAGTGTTTGGGG No data
1001889827_1001889833 -5 Left 1001889827 5:175329535-175329557 CCCACGGCTCCTCTATGCAGAGG No data
Right 1001889833 5:175329553-175329575 AGAGGAAACTGTAGTGTTTGGGG No data
1001889829_1001889833 -6 Left 1001889829 5:175329536-175329558 CCACGGCTCCTCTATGCAGAGGA No data
Right 1001889833 5:175329553-175329575 AGAGGAAACTGTAGTGTTTGGGG No data
1001889824_1001889833 19 Left 1001889824 5:175329511-175329533 CCAATGGTCAACTCCTTCATGCA No data
Right 1001889833 5:175329553-175329575 AGAGGAAACTGTAGTGTTTGGGG No data
1001889826_1001889833 6 Left 1001889826 5:175329524-175329546 CCTTCATGCAGCCCACGGCTCCT No data
Right 1001889833 5:175329553-175329575 AGAGGAAACTGTAGTGTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001889833 Original CRISPR AGAGGAAACTGTAGTGTTTG GGG Intergenic