ID: 1001891957

View in Genome Browser
Species Human (GRCh38)
Location 5:175347025-175347047
Sequence TTCCTAAGGAATCATGTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001891947_1001891957 18 Left 1001891947 5:175346984-175347006 CCACCAATACCAGGACACCCTCC No data
Right 1001891957 5:175347025-175347047 TTCCTAAGGAATCATGTCTCTGG No data
1001891948_1001891957 15 Left 1001891948 5:175346987-175347009 CCAATACCAGGACACCCTCCAAA No data
Right 1001891957 5:175347025-175347047 TTCCTAAGGAATCATGTCTCTGG No data
1001891949_1001891957 9 Left 1001891949 5:175346993-175347015 CCAGGACACCCTCCAAACATCCA No data
Right 1001891957 5:175347025-175347047 TTCCTAAGGAATCATGTCTCTGG No data
1001891946_1001891957 24 Left 1001891946 5:175346978-175347000 CCTCATCCACCAATACCAGGACA No data
Right 1001891957 5:175347025-175347047 TTCCTAAGGAATCATGTCTCTGG No data
1001891951_1001891957 0 Left 1001891951 5:175347002-175347024 CCTCCAAACATCCATCAGAGCCC No data
Right 1001891957 5:175347025-175347047 TTCCTAAGGAATCATGTCTCTGG No data
1001891950_1001891957 1 Left 1001891950 5:175347001-175347023 CCCTCCAAACATCCATCAGAGCC No data
Right 1001891957 5:175347025-175347047 TTCCTAAGGAATCATGTCTCTGG No data
1001891952_1001891957 -3 Left 1001891952 5:175347005-175347027 CCAAACATCCATCAGAGCCCTTC No data
Right 1001891957 5:175347025-175347047 TTCCTAAGGAATCATGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001891957 Original CRISPR TTCCTAAGGAATCATGTCTC TGG Intergenic
No off target data available for this crispr