ID: 1001894462

View in Genome Browser
Species Human (GRCh38)
Location 5:175366505-175366527
Sequence AAACCCTGCTTCGCAAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001894462_1001894463 10 Left 1001894462 5:175366505-175366527 CCTATCTTTGCGAAGCAGGGTTT No data
Right 1001894463 5:175366538-175366560 CAGTGAGTTAAACAAGATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001894462 Original CRISPR AAACCCTGCTTCGCAAAGAT AGG (reversed) Intergenic
No off target data available for this crispr