ID: 1001894999

View in Genome Browser
Species Human (GRCh38)
Location 5:175371088-175371110
Sequence CACTCCAGACTGGCAATAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001894994_1001894999 17 Left 1001894994 5:175371048-175371070 CCGGAGGCGGAGCTTGCAGTGAG No data
Right 1001894999 5:175371088-175371110 CACTCCAGACTGGCAATAGAGGG No data
1001894992_1001894999 19 Left 1001894992 5:175371046-175371068 CCCCGGAGGCGGAGCTTGCAGTG No data
Right 1001894999 5:175371088-175371110 CACTCCAGACTGGCAATAGAGGG No data
1001894993_1001894999 18 Left 1001894993 5:175371047-175371069 CCCGGAGGCGGAGCTTGCAGTGA No data
Right 1001894999 5:175371088-175371110 CACTCCAGACTGGCAATAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001894999 Original CRISPR CACTCCAGACTGGCAATAGA GGG Intergenic