ID: 1001894999 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:175371088-175371110 |
| Sequence | CACTCCAGACTGGCAATAGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1001894994_1001894999 | 17 | Left | 1001894994 | 5:175371048-175371070 | CCGGAGGCGGAGCTTGCAGTGAG | No data | ||
| Right | 1001894999 | 5:175371088-175371110 | CACTCCAGACTGGCAATAGAGGG | No data | ||||
| 1001894992_1001894999 | 19 | Left | 1001894992 | 5:175371046-175371068 | CCCCGGAGGCGGAGCTTGCAGTG | No data | ||
| Right | 1001894999 | 5:175371088-175371110 | CACTCCAGACTGGCAATAGAGGG | No data | ||||
| 1001894993_1001894999 | 18 | Left | 1001894993 | 5:175371047-175371069 | CCCGGAGGCGGAGCTTGCAGTGA | No data | ||
| Right | 1001894999 | 5:175371088-175371110 | CACTCCAGACTGGCAATAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1001894999 | Original CRISPR | CACTCCAGACTGGCAATAGA GGG | Intergenic | ||