ID: 1001901361

View in Genome Browser
Species Human (GRCh38)
Location 5:175432950-175432972
Sequence ACCACAGAGGTGCACAGTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001901352_1001901361 20 Left 1001901352 5:175432907-175432929 CCCGCCTTGGTTCTCCCCAAACC No data
Right 1001901361 5:175432950-175432972 ACCACAGAGGTGCACAGTCACGG No data
1001901358_1001901361 -1 Left 1001901358 5:175432928-175432950 CCTCACTCTTCTCCTGAGAGATA No data
Right 1001901361 5:175432950-175432972 ACCACAGAGGTGCACAGTCACGG No data
1001901354_1001901361 16 Left 1001901354 5:175432911-175432933 CCTTGGTTCTCCCCAAACCTCAC No data
Right 1001901361 5:175432950-175432972 ACCACAGAGGTGCACAGTCACGG No data
1001901350_1001901361 24 Left 1001901350 5:175432903-175432925 CCTCCCCGCCTTGGTTCTCCCCA No data
Right 1001901361 5:175432950-175432972 ACCACAGAGGTGCACAGTCACGG No data
1001901351_1001901361 21 Left 1001901351 5:175432906-175432928 CCCCGCCTTGGTTCTCCCCAAAC No data
Right 1001901361 5:175432950-175432972 ACCACAGAGGTGCACAGTCACGG No data
1001901357_1001901361 4 Left 1001901357 5:175432923-175432945 CCAAACCTCACTCTTCTCCTGAG No data
Right 1001901361 5:175432950-175432972 ACCACAGAGGTGCACAGTCACGG No data
1001901353_1001901361 19 Left 1001901353 5:175432908-175432930 CCGCCTTGGTTCTCCCCAAACCT No data
Right 1001901361 5:175432950-175432972 ACCACAGAGGTGCACAGTCACGG No data
1001901355_1001901361 6 Left 1001901355 5:175432921-175432943 CCCCAAACCTCACTCTTCTCCTG No data
Right 1001901361 5:175432950-175432972 ACCACAGAGGTGCACAGTCACGG No data
1001901356_1001901361 5 Left 1001901356 5:175432922-175432944 CCCAAACCTCACTCTTCTCCTGA No data
Right 1001901361 5:175432950-175432972 ACCACAGAGGTGCACAGTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001901361 Original CRISPR ACCACAGAGGTGCACAGTCA CGG Intergenic
No off target data available for this crispr