ID: 1001901440

View in Genome Browser
Species Human (GRCh38)
Location 5:175433818-175433840
Sequence CTGTTTCAGCAGAATTAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001901436_1001901440 26 Left 1001901436 5:175433769-175433791 CCTTTGCCAGTCAGGAACATACT No data
Right 1001901440 5:175433818-175433840 CTGTTTCAGCAGAATTAGTGTGG No data
1001901437_1001901440 20 Left 1001901437 5:175433775-175433797 CCAGTCAGGAACATACTGTTTTA No data
Right 1001901440 5:175433818-175433840 CTGTTTCAGCAGAATTAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001901440 Original CRISPR CTGTTTCAGCAGAATTAGTG TGG Intergenic
No off target data available for this crispr