ID: 1001902632

View in Genome Browser
Species Human (GRCh38)
Location 5:175444379-175444401
Sequence GATCCCCGCGCAGCACGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 59}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001902626_1001902632 1 Left 1001902626 5:175444355-175444377 CCCTGGTTACCTCGCCAGTCTCC 0: 1
1: 0
2: 0
3: 23
4: 123
Right 1001902632 5:175444379-175444401 GATCCCCGCGCAGCACGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 59
1001902621_1001902632 20 Left 1001902621 5:175444336-175444358 CCCGGTGAGTGCTTGCCCTCCCT 0: 1
1: 0
2: 3
3: 18
4: 182
Right 1001902632 5:175444379-175444401 GATCCCCGCGCAGCACGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 59
1001902629_1001902632 -8 Left 1001902629 5:175444364-175444386 CCTCGCCAGTCTCCGGATCCCCG 0: 1
1: 0
2: 0
3: 8
4: 127
Right 1001902632 5:175444379-175444401 GATCCCCGCGCAGCACGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 59
1001902625_1001902632 4 Left 1001902625 5:175444352-175444374 CCTCCCTGGTTACCTCGCCAGTC 0: 1
1: 0
2: 3
3: 7
4: 75
Right 1001902632 5:175444379-175444401 GATCCCCGCGCAGCACGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 59
1001902624_1001902632 5 Left 1001902624 5:175444351-175444373 CCCTCCCTGGTTACCTCGCCAGT 0: 1
1: 0
2: 3
3: 16
4: 106
Right 1001902632 5:175444379-175444401 GATCCCCGCGCAGCACGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 59
1001902620_1001902632 21 Left 1001902620 5:175444335-175444357 CCCCGGTGAGTGCTTGCCCTCCC 0: 1
1: 0
2: 0
3: 15
4: 121
Right 1001902632 5:175444379-175444401 GATCCCCGCGCAGCACGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 59
1001902627_1001902632 0 Left 1001902627 5:175444356-175444378 CCTGGTTACCTCGCCAGTCTCCG 0: 1
1: 0
2: 0
3: 6
4: 57
Right 1001902632 5:175444379-175444401 GATCCCCGCGCAGCACGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 59
1001902622_1001902632 19 Left 1001902622 5:175444337-175444359 CCGGTGAGTGCTTGCCCTCCCTG 0: 1
1: 0
2: 2
3: 22
4: 213
Right 1001902632 5:175444379-175444401 GATCCCCGCGCAGCACGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001902632 Original CRISPR GATCCCCGCGCAGCACGCGC AGG Intergenic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900516630 1:3085287-3085309 GATCCCAGCCCAGCAAGCGAAGG - Intronic
900985635 1:6071572-6071594 GATACCTGCCCAGCACGCGGAGG - Intronic
901084434 1:6602046-6602068 GCGCCTCGCGCAGCAGGCGCAGG + Exonic
901391491 1:8949159-8949181 GGTCCCCGCCCAGCAGGCCCTGG + Intronic
1065099848 10:22321737-22321759 GAGCCCCGCGCGGCCCCCGCCGG - Intronic
1071858001 10:89645147-89645169 GATCCCCGCGCACCCCCAGCCGG + Exonic
1073137740 10:101229066-101229088 GAGCCCCGCGCAGCGCGCCCCGG - Exonic
1073491475 10:103855691-103855713 GATCCCCCCGGAGCCCGAGCCGG - Intergenic
1074869308 10:117564636-117564658 GAGCCCCTGGGAGCACGCGCCGG + Intergenic
1077505879 11:2929777-2929799 GAGCCCCGGGAAGCACCCGCGGG + Intergenic
1078259891 11:9695707-9695729 GATACCTGTGCAGCACGTGCAGG - Intronic
1081794624 11:45810972-45810994 GCTCCCCGAGCAGCAGGAGCAGG - Exonic
1081938195 11:46918709-46918731 GGGCCCCGCGCAGGAGGCGCCGG - Intergenic
1082979539 11:59106989-59107011 GATGAGCGCGCAGCGCGCGCAGG - Intergenic
1083176138 11:60951530-60951552 GATGCCCGCGCCGCGCGCCCGGG - Exonic
1083579238 11:63814057-63814079 GATCCACGCCCCGCACGCTCCGG + Intronic
1089109774 11:116046232-116046254 GATCCCCGAGCAGCTCGCCTTGG + Intergenic
1104917179 12:132271784-132271806 GAGCCCCGCACAGAACGTGCAGG + Intronic
1117176659 14:53152912-53152934 GTTCCCCGCGCAGCAGGGCCAGG + Exonic
1128294252 15:66504578-66504600 GTTCCCAGCACAGGACGCGCCGG - Intronic
1154216526 18:12420382-12420404 CATCCACGCCCAGCACGCTCGGG - Exonic
1156036098 18:32769997-32770019 GATCGCCGCGCTGCACGGCCTGG - Exonic
1160930383 19:1567369-1567391 GAGCCCAGCCCAGCCCGCGCCGG - Intronic
1161766692 19:6212515-6212537 GACCCCAGCGCAGCGCGAGCCGG + Intergenic
1163597050 19:18226341-18226363 GATCCCCGCGCGGCTCCCCCGGG - Intronic
1167382945 19:49149147-49149169 GATCCCCACGCAGAATGCACAGG + Exonic
1167705677 19:51079629-51079651 GAACCACGCGCAGCACCTGCTGG + Exonic
930529605 2:52572728-52572750 GATCCCAGCTCAGCCCGGGCCGG - Intergenic
932761733 2:74442245-74442267 GATCGCCGCGTAGCACGCTCTGG + Intronic
933415826 2:81985346-81985368 AATTCCAGCGCAGCACGGGCGGG - Intergenic
933666896 2:84971369-84971391 GGTCCCGGCGCTGCCCGCGCCGG - Exonic
933876148 2:86623439-86623461 CCTCCCCGCGCAGAACACGCTGG - Exonic
934670286 2:96208317-96208339 GCTGCGCGCGCCGCACGCGCAGG + Exonic
935746404 2:106193773-106193795 TATCCCCACGCGGCACGCTCCGG + Intronic
936452872 2:112646292-112646314 GGTCCCCGGGCGGCGCGCGCGGG + Intronic
937783410 2:125866732-125866754 GATACACGTGCAGAACGCGCAGG + Intergenic
944658100 2:201897216-201897238 GATCCCCGGGCAGGGCGCGGTGG + Intergenic
946917565 2:224540714-224540736 GATCCACGTGCAGAACGTGCAGG + Intronic
1176143686 20:63556026-63556048 GGTCCCCGAGCAGCAGGAGCTGG - Exonic
1185228532 22:49667623-49667645 GCCCCCAGCCCAGCACGCGCAGG + Intergenic
1185228567 22:49667721-49667743 GCCCCCAGCTCAGCACGCGCAGG + Intergenic
1185228602 22:49667819-49667841 GCCCCCAGCCCAGCACGCGCAGG + Intergenic
1185228656 22:49667966-49667988 GCCCCCAGCTCAGCACGCGCAGG + Intergenic
1185228690 22:49668064-49668086 GCCCCCAGCTCAGCACGCGCAGG + Intergenic
968051561 3:195658266-195658288 GATCCCCGGGCAGGGGGCGCGGG - Intergenic
968104255 3:195990067-195990089 GATCCCCGGGCAGGGGGCGCGGG + Intergenic
968302556 3:197627657-197627679 GATCCCCGGGCAGGGGGCGCGGG + Intergenic
975683397 4:76897514-76897536 GCTCCCCGCGAGGCGCGCGCCGG - Exonic
979764194 4:124445343-124445365 GGTCCCCACGCAGCATGCTCAGG + Intergenic
985111932 4:186555308-186555330 CGTCCCCGCGGAGCACGGGCTGG + Exonic
1001902632 5:175444379-175444401 GATCCCCGCGCAGCACGCGCAGG + Intergenic
1002091752 5:176810376-176810398 CCGCCCCGCGCAGCGCGCGCGGG - Intergenic
1003035037 6:2634430-2634452 AAGCCCCGCACAGCACGCGGTGG - Intronic
1019246383 6:170712851-170712873 GATCCCCCCGGAGCAGGCCCAGG + Intergenic
1024963787 7:55004568-55004590 GAGCCCCGCGCAGCCAGAGCAGG + Intergenic
1027200907 7:76063354-76063376 GATCCAAGCGCAGCAGGGGCTGG + Intronic
1035221339 7:157408194-157408216 GGTCCCCTGGCAGGACGCGCGGG + Intronic
1035266690 7:157693298-157693320 GATCCCCTCCCAGCCCCCGCGGG - Intronic
1042367294 8:67952185-67952207 GAGCCCCGCGCCCCCCGCGCCGG + Exonic
1059800445 9:117745026-117745048 GAGCCCCGCGCAGCCCGCGAAGG - Intergenic
1061614790 9:131772730-131772752 GAGCCCCGCCCAGCACTGGCTGG + Intergenic
1199772743 X:150984411-150984433 GATCCGCGCGCGGCCGGCGCGGG - Intronic