ID: 1001903044

View in Genome Browser
Species Human (GRCh38)
Location 5:175446532-175446554
Sequence TAAGCCAAGGTGCCAAAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001903044_1001903050 14 Left 1001903044 5:175446532-175446554 CCGGCCTTTGGCACCTTGGCTTA No data
Right 1001903050 5:175446569-175446591 TATTGCTGGCACAGACCCTCCGG No data
1001903044_1001903048 0 Left 1001903044 5:175446532-175446554 CCGGCCTTTGGCACCTTGGCTTA No data
Right 1001903048 5:175446555-175446577 AGATGAAAGGACCATATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001903044 Original CRISPR TAAGCCAAGGTGCCAAAGGC CGG (reversed) Intergenic
No off target data available for this crispr