ID: 1001904167

View in Genome Browser
Species Human (GRCh38)
Location 5:175457265-175457287
Sequence GGTGTTGGTGAGGATGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001904158_1001904167 27 Left 1001904158 5:175457215-175457237 CCACCTCACACCCATTAGGATGG 0: 36
1: 174
2: 534
3: 1498
4: 16247
Right 1001904167 5:175457265-175457287 GGTGTTGGTGAGGATGTAGAGGG No data
1001904162_1001904167 16 Left 1001904162 5:175457226-175457248 CCATTAGGATGGCTACTATCAAA 0: 60
1: 252
2: 493
3: 894
4: 1498
Right 1001904167 5:175457265-175457287 GGTGTTGGTGAGGATGTAGAGGG No data
1001904160_1001904167 24 Left 1001904160 5:175457218-175457240 CCTCACACCCATTAGGATGGCTA 0: 48
1: 225
2: 513
3: 1080
4: 1791
Right 1001904167 5:175457265-175457287 GGTGTTGGTGAGGATGTAGAGGG No data
1001904161_1001904167 17 Left 1001904161 5:175457225-175457247 CCCATTAGGATGGCTACTATCAA 0: 55
1: 222
2: 686
3: 1736
4: 3640
Right 1001904167 5:175457265-175457287 GGTGTTGGTGAGGATGTAGAGGG No data
1001904157_1001904167 28 Left 1001904157 5:175457214-175457236 CCCACCTCACACCCATTAGGATG No data
Right 1001904167 5:175457265-175457287 GGTGTTGGTGAGGATGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001904167 Original CRISPR GGTGTTGGTGAGGATGTAGA GGG Intergenic
No off target data available for this crispr