ID: 1001906348

View in Genome Browser
Species Human (GRCh38)
Location 5:175476745-175476767
Sequence ATAAGACAACTGCAAAACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001906348_1001906349 -10 Left 1001906348 5:175476745-175476767 CCAAGGTTTTGCAGTTGTCTTAT No data
Right 1001906349 5:175476758-175476780 GTTGTCTTATAGCATTACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001906348 Original CRISPR ATAAGACAACTGCAAAACCT TGG (reversed) Intergenic
No off target data available for this crispr