ID: 1001907645

View in Genome Browser
Species Human (GRCh38)
Location 5:175486336-175486358
Sequence CCAGGTTGCATGGCAGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 243}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001907645_1001907650 -3 Left 1001907645 5:175486336-175486358 CCAGCATCTGCCATGCAACCTGG 0: 1
1: 0
2: 2
3: 16
4: 243
Right 1001907650 5:175486356-175486378 TGGGCAAGTTATTTCCCCTCTGG 0: 1
1: 1
2: 4
3: 54
4: 263
1001907645_1001907655 27 Left 1001907645 5:175486336-175486358 CCAGCATCTGCCATGCAACCTGG 0: 1
1: 0
2: 2
3: 16
4: 243
Right 1001907655 5:175486386-175486408 CTTCCGCATAATAAGCGCATTGG 0: 1
1: 0
2: 0
3: 0
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001907645 Original CRISPR CCAGGTTGCATGGCAGATGC TGG (reversed) Intronic
900159832 1:1218280-1218302 CCAGGCTGCATGGCCGTTGTTGG - Intronic
902533020 1:17102664-17102686 CCAGGCTGCAGGGGAGAGGCAGG + Intronic
902646026 1:17798457-17798479 ACAGCTCGCCTGGCAGATGCTGG + Intronic
904385880 1:30141772-30141794 CCATCTTGCATGGAAGCTGCAGG - Intergenic
906130040 1:43450531-43450553 CCAGATTGCCTGCCAGAGGCAGG + Exonic
906698889 1:47843275-47843297 CCAGGGTGCAGGGCAGACGCAGG + Intronic
911852776 1:102839654-102839676 CCAGATTGCTTGGCAAAAGCAGG + Intergenic
912773781 1:112490531-112490553 CCAGGTTGGAGTGCAGAGGCAGG + Intronic
913179694 1:116309651-116309673 TCAAGTTGCAAGGCAGATCCAGG - Intergenic
915078973 1:153338262-153338284 CCAGGGTGCAGGGCAGATCAGGG - Intronic
915155510 1:153872273-153872295 CCAGGTTGGAGTGCAGAGGCGGG - Intronic
916192794 1:162195446-162195468 CCAGGTACCATGCCAGGTGCTGG - Intronic
916428909 1:164708941-164708963 CCAGGTACCATGGTAGGTGCTGG + Intronic
916828192 1:168463613-168463635 CCAGGCTGGATGGCAGAGGAGGG - Intergenic
917507283 1:175639086-175639108 CCAGCTTCCATGAGAGATGCTGG - Intronic
917600665 1:176570723-176570745 CCAGGTGCCATGGCAGAGGAGGG + Intronic
921979773 1:221243269-221243291 CCAGGCTCTATGCCAGATGCTGG - Intergenic
922069074 1:222173581-222173603 ACATCTTGCATGGCAGAAGCAGG + Intergenic
923221770 1:231901406-231901428 GCATGGTGCATGGCAAATGCAGG + Intronic
924055506 1:240120556-240120578 CAAGTTTGCAAGGTAGATGCTGG + Intronic
924313972 1:242776557-242776579 GCATGTTACATGGCAGAAGCAGG + Intergenic
1064944337 10:20771316-20771338 CCAGGTTGACAGGCAGTTGCTGG - Intergenic
1069876837 10:71568296-71568318 CCAGGCTGCATGGAAGGTGCAGG - Intronic
1072526557 10:96276754-96276776 CAAGGAAGCGTGGCAGATGCTGG + Intergenic
1072726411 10:97816750-97816772 CCAGGTGGCCTGACAGTTGCTGG + Intergenic
1073352140 10:102827552-102827574 CCAGGGTAAATGGCAGATGAAGG + Intergenic
1074423879 10:113333771-113333793 CCAGGTTCCATGGCAGGCACTGG + Intergenic
1074446147 10:113522587-113522609 CCAGGCTGCATGGAGGAGGCAGG + Intergenic
1074608913 10:115002532-115002554 TCAGGTGGGATGGTAGATGCTGG + Intergenic
1076110747 10:127857246-127857268 CCATGGTGCCTTGCAGATGCTGG + Intergenic
1076865062 10:133162384-133162406 CAAGGGTGCAGGGCAGCTGCCGG + Intronic
1077775618 11:5268510-5268532 GCAGGCTGCCTGGCAGAAGCTGG - Exonic
1078474483 11:11619836-11619858 CCAGGTTGAGAGGCAGAGGCAGG + Intronic
1079403604 11:20126213-20126235 CCAGGAAGCATGGCTGAGGCTGG - Intergenic
1081583037 11:44365541-44365563 CCAGGATCCATGGAAGATGCTGG - Intergenic
1081763800 11:45595239-45595261 CAGGGTTACATGGCAGAAGCTGG + Intergenic
1084334453 11:68448578-68448600 GCAGGCTGCAGGGCAGGTGCGGG + Intronic
1084868100 11:72076328-72076350 CCAGGTTGGAGTGCAGTTGCAGG - Intronic
1085397579 11:76214564-76214586 CCAGGCCACCTGGCAGATGCTGG + Intergenic
1087852767 11:103051530-103051552 ACAGGTTTACTGGCAGATGCAGG + Intergenic
1088365718 11:109037935-109037957 CCAGGGTGTAAGGCAGATGAGGG + Intergenic
1088772570 11:113049855-113049877 TCAGGTGGCATGGCTGAAGCAGG + Intronic
1089348288 11:117805953-117805975 CCAGGTCACATGGCAGAGTCAGG + Intronic
1090780244 11:130001816-130001838 CCAGGGTGCAGCGCAGAGGCAGG - Intronic
1092086423 12:5766612-5766634 ATTGGTTGCATGGAAGATGCAGG + Intronic
1095443971 12:42266952-42266974 CCAGGTAGCAGTGCAGGTGCCGG + Intronic
1097714962 12:62956013-62956035 CCATGCTGCATGGCTGCTGCAGG + Intergenic
1099256576 12:80321943-80321965 CCAGGTTGCACTGCAGCTGAGGG + Intronic
1102027283 12:109720683-109720705 CCAGGCTCCCTGCCAGATGCTGG + Intronic
1103444212 12:120983392-120983414 CCACGTTACAGGGCAGATGTGGG + Intronic
1103953511 12:124564823-124564845 CCAGCATGAATGGCAGACGCTGG + Intronic
1109182565 13:59231427-59231449 CCAGGGTGCATGTCAAATTCAGG + Intergenic
1109237921 13:59847311-59847333 CCATGTTCCATAGCAGATGAAGG - Intronic
1111209728 13:85062171-85062193 CCAGGTTGCTGGGCACATGGAGG - Intergenic
1112299289 13:98215651-98215673 CCAGGTGCCATGCTAGATGCTGG - Intronic
1113654383 13:112058656-112058678 CCAGGTGGCAGGGCTGAAGCAGG + Intergenic
1114608139 14:24015035-24015057 CCATGTTGGATGCCAGATGAAGG + Intergenic
1117416107 14:55497968-55497990 CCAGGCTGCAGTGCAGTTGCAGG + Intergenic
1118546709 14:66897801-66897823 CTAGGTTCCATGGCAGTTGCAGG + Intronic
1120558540 14:85960630-85960652 CCAGGTTGCCTCTCTGATGCTGG + Intergenic
1121404783 14:93713036-93713058 CCAGCTTGCAGTGCAGAAGCTGG + Intergenic
1121424562 14:93840387-93840409 GCAGGTGGCATGGCTGCTGCTGG - Intergenic
1121761884 14:96452700-96452722 CCAGGCTGCAGGGCAGTGGCAGG + Intronic
1122158197 14:99763853-99763875 CCACCTTGCATGGCAGAGGTGGG - Intronic
1123139436 14:106061109-106061131 CCACGGTGGATGGCAGATGCAGG + Intergenic
1123156676 14:106234020-106234042 CCATGGTGGACGGCAGATGCAGG + Intergenic
1123207450 14:106727115-106727137 CCATGCTGGACGGCAGATGCAGG + Intergenic
1123212473 14:106774109-106774131 CCATGCTGGATGGCAGATGCAGG + Intergenic
1202904332 14_GL000194v1_random:59776-59798 CCATGCTGCCTGGCAGAGGCTGG + Intergenic
1124372456 15:29111365-29111387 TCAGGATGCAGGGGAGATGCTGG + Intronic
1125372994 15:38998560-38998582 CCAGATTGCAGTGAAGATGCTGG + Intergenic
1127143126 15:55997045-55997067 CCAGGTTACAAGGCAGAGGAAGG + Intergenic
1128151366 15:65365426-65365448 TTAGGTTGCAGTGCAGATGCAGG - Intronic
1130099407 15:80881027-80881049 CCAGGTGGCATGGCAGAAGGAGG + Exonic
1131071930 15:89471479-89471501 CCAGGGAGCATAGGAGATGCTGG + Exonic
1131150261 15:90043232-90043254 CCAGGTAGCGGGGCAGATGAGGG - Intronic
1132323102 15:100941833-100941855 CCAGGCTGCCTGGCACAAGCTGG + Intronic
1135174993 16:20220057-20220079 CCAGGTATCATGCTAGATGCTGG - Intergenic
1136359632 16:29770401-29770423 CCAGGTGTGATGCCAGATGCTGG + Intergenic
1136870096 16:33799002-33799024 CCAAGCTGTACGGCAGATGCAGG - Intergenic
1137268914 16:46889987-46890009 CCAGATTCCAAGGCAGAAGCAGG - Intronic
1138412363 16:56850650-56850672 CCAGAATGCATGCCACATGCTGG - Intergenic
1138430663 16:56966540-56966562 CCGGGCTGCAGGGGAGATGCCGG - Intronic
1139848279 16:69935562-69935584 CCAGCGTGCGGGGCAGATGCGGG + Intronic
1140266640 16:73427030-73427052 CCATGATTCATGGCTGATGCTGG + Intergenic
1141157314 16:81606336-81606358 CCAGGGTGCATGGGAGAGCCAGG + Intronic
1141663626 16:85454503-85454525 CCAGGCTCCTGGGCAGATGCCGG + Intergenic
1141811460 16:86378976-86378998 CAGGGTTACATGGAAGATGCAGG - Intergenic
1203102075 16_KI270728v1_random:1317052-1317074 CCAAGCTGTACGGCAGATGCAGG + Intergenic
1142703630 17:1679889-1679911 CCAGTTTCCATAGCAGATACAGG - Intronic
1142756215 17:2018048-2018070 CCAGGCAGGATGGCAGCTGCAGG - Intronic
1144728385 17:17513072-17513094 CCAGGTTGCAGGGCAGGCCCAGG + Intronic
1145918066 17:28588363-28588385 AGAGGATGCATGGCAGATTCAGG + Intronic
1145993818 17:29094394-29094416 TCAGGATGCATGGCAGCTGAGGG - Intronic
1146530677 17:33605229-33605251 GCAGGTTGCAGTGCAGAAGCGGG + Intronic
1146636689 17:34511710-34511732 CCAGGTTGTATTGTAGGTGCTGG + Intergenic
1147363759 17:39946967-39946989 CCAGGCAGAAGGGCAGATGCGGG - Intergenic
1147630185 17:41925224-41925246 CCAGGGTGGAGGGCAGTTGCAGG - Intronic
1148002438 17:44397728-44397750 CCAGGATGGATGGCTGAGGCGGG + Exonic
1148274087 17:46288183-46288205 CCAGGCTGCAGGGCAGGGGCAGG + Intronic
1148454107 17:47801685-47801707 CCAGGCTGCATGGGAGGTGGTGG + Intergenic
1148632226 17:49119973-49119995 CCAGGCAGCAGGGCAGATGTGGG + Intergenic
1149779703 17:59387596-59387618 CCAGATTGCATGGCAGGCTCTGG + Intronic
1150408967 17:64926387-64926409 CCAGGCTGCAGGGCAGGGGCAGG - Intergenic
1150418010 17:65003087-65003109 CCAGGGTGGATTGCAGAAGCAGG - Intergenic
1151445423 17:74160574-74160596 CAGGGTGGCATGGCAGGTGCTGG - Intergenic
1152100162 17:78296755-78296777 CCAGGTTCCATGCCAGGAGCTGG + Intergenic
1152178083 17:78800844-78800866 CCAGGGTCCATGCCAGGTGCTGG - Intronic
1152471502 17:80492300-80492322 CCAGGTGGCAGGGCAGGTGGCGG + Intergenic
1152471525 17:80492374-80492396 CCAGGTGGCAGGGCAGGTGGCGG + Intergenic
1152780059 17:82223323-82223345 CCAGGCGTCATGGCACATGCCGG - Intergenic
1155348569 18:24883589-24883611 CCTGGTTGCTTGTCAGGTGCAGG + Intergenic
1158197421 18:54904685-54904707 CCAGGTGGAATGGCAGATACAGG - Intronic
1160227981 18:77026009-77026031 GCAGGTTCCATGGCACAGGCTGG - Intronic
1160667732 19:340933-340955 ACAGAGTGCATGGCAGCTGCAGG + Intronic
1160933082 19:1579810-1579832 CCAGGTTGAATTGCAGTGGCAGG + Intronic
1164804823 19:31108661-31108683 CCAGGCTGCAAGTCAGATTCAGG - Intergenic
1166118153 19:40668084-40668106 CCAGGCTGGAAGGCAGCTGCAGG + Exonic
1166183368 19:41123931-41123953 CCAGGCTGCATGGGAGAGGTAGG - Intronic
1166408470 19:42540466-42540488 CCATGTTGCAGGGCTGCTGCGGG + Intronic
1167886397 19:52503387-52503409 CCAGGTTGTATTGCAGTGGCGGG + Intronic
1168519208 19:57035238-57035260 CCAGGCTGCAGGGTATATGCAGG + Intergenic
1168563567 19:57403902-57403924 CCAGCTTCCAAGGCAGAAGCCGG + Intronic
926711232 2:15882972-15882994 CCAGGATGCATGGGAAAGGCAGG - Intergenic
929073969 2:38062024-38062046 GCAGGTAGCATGGCAGCTGCTGG - Intronic
929688517 2:44055413-44055435 GCAGATTGCATGGCAGCTGGTGG - Intergenic
929868337 2:45737083-45737105 CCATGCTGCAGGGGAGATGCCGG - Intronic
932803886 2:74766770-74766792 CCTGCTTGCATGGCAGCTGAGGG - Intergenic
934502313 2:94870625-94870647 CCAGGCTGCCTGGCGGAGGCTGG - Intergenic
937269356 2:120638172-120638194 CCAGGATGCTGGGTAGATGCAGG - Intergenic
937358504 2:121213084-121213106 CCACGTTGCAGGGCGGCTGCCGG + Intergenic
937432700 2:121852801-121852823 CCAGGATGCATAGGAGATGGCGG - Intergenic
940716772 2:157235065-157235087 CCTGGTACCATGGCAAATGCTGG - Intergenic
940986101 2:160053686-160053708 CCAGGTTGCATTGAAGTTGGGGG - Intronic
942939943 2:181605190-181605212 CCAGGTCACAGGGCAGATACAGG + Intronic
945076638 2:206046529-206046551 CCAGGTTGCATGGTCCATCCGGG - Exonic
946961639 2:224991676-224991698 CCAGGGTGCATGGCTGAGTCAGG + Intronic
947899304 2:233707079-233707101 CCACTTTGCATGGCAGCTGAGGG + Intronic
948688408 2:239686222-239686244 CCAGGTGGCATGGACAATGCTGG - Intergenic
949050669 2:241895839-241895861 CCAGGGCACATGGCACATGCAGG + Intronic
1169571829 20:6914662-6914684 CCAGGCTGGATGGCAGTGGCAGG - Intergenic
1169590116 20:7131584-7131606 CCAGGTTGCATGCCTAATGCCGG + Intergenic
1169673132 20:8126472-8126494 CCAGATTTCATGGAAAATGCAGG - Intergenic
1169794515 20:9447338-9447360 CCAGTTTGGTTGGCAGATGGGGG + Intronic
1170335639 20:15267484-15267506 CCAGCTTGCATGCCAGACTCTGG - Intronic
1171399299 20:24861360-24861382 ACTGGTTGCTTGGCAGTTGCAGG - Intergenic
1171415891 20:24980146-24980168 CCATGTTGGGTGCCAGATGCTGG - Intronic
1171457468 20:25280163-25280185 CCAGGATCCCAGGCAGATGCTGG - Intronic
1172121622 20:32602231-32602253 CCAGGTTGGAAGTCAGGTGCAGG - Intronic
1175404538 20:58717769-58717791 CCAGGCTTCCTGGCGGATGCCGG - Intronic
1175751168 20:61499045-61499067 CCAGGCTGCATGGCGGGGGCAGG + Intronic
1175915383 20:62423543-62423565 CCAGCCCACATGGCAGATGCTGG - Intronic
1176127524 20:63482586-63482608 CCAGGATGGAGAGCAGATGCAGG - Intergenic
1178991197 21:37358219-37358241 CCAGGGTTCAGGGTAGATGCTGG - Intergenic
1180020304 21:45120257-45120279 CAAGTTTGCATGTCAGATGTTGG + Intronic
1180063954 21:45403907-45403929 CCAGGTTTGAAGGCAGATGCTGG + Intergenic
1180915938 22:19487147-19487169 CCAGGAGCAATGGCAGATGCCGG + Intronic
1182112269 22:27732299-27732321 CAGGTTTGCATGGCAGAAGCAGG + Intergenic
1182516559 22:30862254-30862276 CCAGGTTGGAGGGCAGCAGCAGG + Intronic
1182521126 22:30885014-30885036 CCAGGTGCCAGGGCAGATGCGGG + Intronic
1184493323 22:44823155-44823177 CCAAGTCACATGGCAGGTGCTGG + Intronic
1184868880 22:47220346-47220368 CCAGATTGCAAGGCTGCTGCAGG - Intergenic
1185124064 22:48995020-48995042 CCTGTTTGCATTCCAGATGCTGG + Intergenic
949394800 3:3603201-3603223 CCAGGTGTGATGGCATATGCCGG + Intergenic
949935225 3:9110932-9110954 ACAGCTAGCATGGCAGACGCCGG - Intronic
950176261 3:10876928-10876950 TCAGGTTCCATGGCAGAACCAGG - Intronic
954411947 3:50374681-50374703 CCAGGGTGCGGGGCAGAGGCAGG + Intronic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
954990043 3:54832808-54832830 CCAGGTTCCATGCCATGTGCTGG - Intronic
955396878 3:58563812-58563834 CCAGGATGCATGCCATAGGCTGG - Intergenic
956654695 3:71537436-71537458 CCAGAATGAATGGAAGATGCAGG + Intronic
957377347 3:79375594-79375616 CAAGGTTGCATTTCAGATGATGG + Intronic
958853284 3:99354488-99354510 CCAGGTTGGAGGGCAGTGGCAGG - Intergenic
959869967 3:111315182-111315204 CCAGATTGAATGACAGAAGCTGG + Intronic
960174228 3:114498188-114498210 CAAGGTAGCATGGCAGATTATGG + Intronic
960903076 3:122571461-122571483 CCAGCTTGAAAGGCAGATGCTGG + Intronic
960990150 3:123304899-123304921 CTAGGTTGCATGGGAGATGAGGG - Intronic
961624017 3:128246921-128246943 CCAGATTGCCTGCCAGAAGCTGG + Exonic
966839753 3:184078836-184078858 ACAGGTTGCATGGAAAATGTGGG - Intergenic
967671822 3:192245595-192245617 CCAGGTAGCATGGAAGGTACTGG + Intronic
968396354 4:242196-242218 CCACGTTGGGTGGCAGATGAAGG - Intergenic
968966335 4:3770803-3770825 CCAGGCTGCAGGGGAGAAGCTGG + Intergenic
971759310 4:30744700-30744722 CAAGGTTGCAAGACTGATGCAGG - Intronic
975439778 4:74398316-74398338 CCACCTTCCATGGAAGATGCAGG - Intergenic
976022639 4:80648011-80648033 CCAGGTTGGAGTGCAGTTGCCGG - Intronic
977685895 4:99847514-99847536 CCAGGTTTCATGTCAAAGGCAGG + Intronic
977686060 4:99848722-99848744 CCAGGTTTCATGTCAAAGGCAGG + Intronic
978478770 4:109163574-109163596 ACAGGCTGCATGGCAGATTTTGG + Intronic
978901496 4:113955473-113955495 CCAGGTTCCATGCCATCTGCAGG + Intronic
980785725 4:137551919-137551941 TCAGGTTGTATGTCAGATTCAGG - Intergenic
983779267 4:171647299-171647321 CCATGTTGCACGGCAGCTGAGGG + Intergenic
985310126 4:188588672-188588694 CCAGGTTTCATGGCTGCTGCAGG + Intergenic
989428816 5:41327956-41327978 CCACTGTGCTTGGCAGATGCTGG + Intronic
992090286 5:73310837-73310859 CCAGAAGGGATGGCAGATGCTGG + Intergenic
992761643 5:79955887-79955909 CTGGGTGACATGGCAGATGCCGG + Intergenic
995291008 5:110453545-110453567 GCACTTTGCATGGCAGAGGCAGG - Intronic
995845080 5:116484871-116484893 ACAGGCTGCATGGCAGAGGATGG + Intronic
996369440 5:122737808-122737830 CCAGGTAGCATGGTAGCTGCTGG - Intergenic
997976086 5:138442020-138442042 GCAGGCAGCATGGCAGAAGCGGG - Intronic
999206353 5:149851037-149851059 CAAGATTTCAAGGCAGATGCAGG - Exonic
1000003627 5:157163447-157163469 GCAGGTGGCATGGCAGTGGCAGG - Exonic
1001141652 5:169149403-169149425 CCAGACTGCAGTGCAGATGCAGG - Intronic
1001907645 5:175486336-175486358 CCAGGTTGCATGGCAGATGCTGG - Intronic
1003045395 6:2728900-2728922 CCACGGTGGATGGCAGATCCTGG + Intronic
1004369338 6:15038614-15038636 CCAGCTTGGAAGGCAGAAGCAGG - Intergenic
1005497594 6:26401795-26401817 CCAGGTTGGAGTGCAGTTGCAGG - Intergenic
1006192973 6:32220760-32220782 CCAGGTTTCTGGGCAGAGGCAGG + Exonic
1010484962 6:76399689-76399711 TCAGGTTGCTTGGTAAATGCAGG + Intergenic
1013226292 6:108121263-108121285 CCAGGATGGATGCCAGGTGCTGG - Intronic
1014640630 6:123905161-123905183 CACAGTTTCATGGCAGATGCTGG + Intronic
1016864166 6:148748605-148748627 CCAGGTCGCAAGGACGATGCTGG + Intronic
1017141329 6:151192731-151192753 CCAGGTTGCATGGGAGAGATGGG + Intergenic
1018728469 6:166631413-166631435 CCAGGTTGGATGGGGGATGAGGG - Intronic
1018819143 6:167359573-167359595 CCAGGCTGCAGGGCAGTGGCAGG + Intronic
1018958182 6:168427358-168427380 CCAGGGAACATGCCAGATGCTGG + Intergenic
1019130214 6:169867867-169867889 CCAGGTTGCAGCGCGGATGTGGG - Intergenic
1019135488 6:169905128-169905150 AAAGGTTGCCTGGCACATGCCGG + Intergenic
1019644397 7:2121329-2121351 CCACGGTGCCTGGCAGGTGCTGG - Intronic
1021509027 7:21415329-21415351 CCAGGTTACCTGGCTGAGGCAGG + Intergenic
1023021559 7:36016172-36016194 CCAGGTTTGGTGGCACATGCTGG + Intergenic
1023869631 7:44256068-44256090 CCAGGTCACATGCCAGGTGCTGG - Intronic
1024704779 7:51944993-51945015 CCAGGCTGCAGGGCAGTGGCGGG - Intergenic
1025480735 7:60979507-60979529 CCAGGTTGCTTGGCAACTCCTGG + Intergenic
1026332525 7:69364955-69364977 GCTGGATGCATGTCAGATGCTGG - Intergenic
1029421680 7:100475224-100475246 CCAGGTGTGATGGCAGGTGCCGG - Intronic
1032085410 7:128880988-128881010 CCAGCTCACATGGCAGGTGCAGG + Exonic
1034182607 7:149149792-149149814 CCAGGTTGGAGGGCAGTGGCAGG - Intronic
1034415375 7:150961831-150961853 GCCTGATGCATGGCAGATGCTGG + Intronic
1034706007 7:153145193-153145215 CCAGGGAGCATGGGAAATGCCGG + Intergenic
1036627075 8:10480933-10480955 CCAGGTTGAGTGGTAGATGGGGG + Intergenic
1037859055 8:22391886-22391908 TCAGGTTGCAGGGGCGATGCAGG + Intronic
1038054943 8:23849368-23849390 AAAGGTTGCATGGAAGATTCCGG + Intronic
1038395789 8:27244542-27244564 CCAGGCTCCCTGGCAAATGCTGG - Intronic
1039725797 8:40215077-40215099 CCAGGTTGCATAGCAAGTGGTGG - Intergenic
1039900532 8:41748989-41749011 CCAGGTTGGAGGGCAGTGGCAGG - Intronic
1040426843 8:47297317-47297339 CCAGGGAGCATGGCAGCTGTGGG + Intronic
1040593698 8:48818634-48818656 GCAGGTGGCAGGGCAGATGGAGG + Intergenic
1042615516 8:70644513-70644535 CCAGGCTGCAGTGCAGAGGCAGG + Intronic
1044728597 8:95212922-95212944 CCAGGTTGCACAGAAGATGGTGG + Intergenic
1044990804 8:97794120-97794142 CCAGGTGTGATGGCAGGTGCTGG - Intronic
1045329935 8:101146846-101146868 CCAGGTGGCTGGGGAGATGCTGG + Intergenic
1045370092 8:101514547-101514569 CCAGATTCCATGGCAGATGCAGG - Intronic
1049856556 8:144865605-144865627 CCAGGCTAAATGCCAGATGCTGG - Intergenic
1049876687 8:145027807-145027829 CCACGTTGGGTGGCAGATGAAGG + Intergenic
1051398219 9:16650047-16650069 CCTGGGTGCATGGCAGAGGAAGG + Intronic
1052904503 9:33821756-33821778 CCAGGTTTCATGGCGCACGCCGG - Intronic
1052915769 9:33923450-33923472 CCATGTTGCTTGGCTGAGGCTGG + Exonic
1053014757 9:34655412-34655434 CCAGGTTGGATGACAGGAGCAGG - Intronic
1054745962 9:68853966-68853988 CCAGCTTGCCTGGCACAAGCCGG - Intronic
1055465235 9:76558936-76558958 CCAGGTAGCCTGGCAGATGCTGG + Intergenic
1055729410 9:79265170-79265192 ACAGGCTGCCTGGCAGAGGCAGG - Intergenic
1056048297 9:82741846-82741868 CCAGGTTGCAAGTCAGGTCCAGG + Intergenic
1061129672 9:128701990-128702012 CCAGGTTGGAGGGCAGTGGCAGG + Intergenic
1203563220 Un_KI270744v1:74509-74531 CCATGCTGCCTGGCAGAGGCTGG - Intergenic
1187213695 X:17254219-17254241 CCAGGCTGCCAGGCAGCTGCTGG - Intergenic
1187426256 X:19180057-19180079 CCAGGTTGTGTGTTAGATGCTGG + Intergenic
1196501788 X:116392242-116392264 CCAGGTTGGAGTGCAGCTGCTGG - Intergenic
1196501864 X:116393367-116393389 CCAGGTTGGAGTGCAGCTGCTGG - Intergenic
1198738786 X:139817972-139817994 ACAGGGTGTATGGCAGAGGCAGG - Intronic
1198896449 X:141460850-141460872 ACAGGTTGAATGGCATATCCGGG + Intergenic
1199516051 X:148676474-148676496 CCAGGTACCATGCCAGAAGCTGG + Intronic
1200423191 Y:2994515-2994537 CCACTTTGCAAGGCAGAGGCAGG - Intergenic