ID: 1001915145

View in Genome Browser
Species Human (GRCh38)
Location 5:175554008-175554030
Sequence GAGGGTCTATTGAGCTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001915137_1001915145 4 Left 1001915137 5:175553981-175554003 CCTATAATCCCAATCTCAGCACT No data
Right 1001915145 5:175554008-175554030 GAGGGTCTATTGAGCTCAGGAGG No data
1001915140_1001915145 -4 Left 1001915140 5:175553989-175554011 CCCAATCTCAGCACTTTGGGAGG 0: 20
1: 313
2: 336
3: 337
4: 646
Right 1001915145 5:175554008-175554030 GAGGGTCTATTGAGCTCAGGAGG No data
1001915136_1001915145 23 Left 1001915136 5:175553962-175553984 CCAGGTGCAGTGGCTCATGCCTA 0: 816
1: 9554
2: 33163
3: 80351
4: 135947
Right 1001915145 5:175554008-175554030 GAGGGTCTATTGAGCTCAGGAGG No data
1001915142_1001915145 -5 Left 1001915142 5:175553990-175554012 CCAATCTCAGCACTTTGGGAGGG No data
Right 1001915145 5:175554008-175554030 GAGGGTCTATTGAGCTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001915145 Original CRISPR GAGGGTCTATTGAGCTCAGG AGG Intergenic
No off target data available for this crispr