ID: 1001917181

View in Genome Browser
Species Human (GRCh38)
Location 5:175571590-175571612
Sequence ATGCAGGAGCAGGGAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001917181_1001917186 -10 Left 1001917181 5:175571590-175571612 CCTTCCTCTCCCTGCTCCTGCAT No data
Right 1001917186 5:175571603-175571625 GCTCCTGCATCCTCCTGGCAAGG No data
1001917181_1001917190 11 Left 1001917181 5:175571590-175571612 CCTTCCTCTCCCTGCTCCTGCAT No data
Right 1001917190 5:175571624-175571646 GGACAGCCTTGTCCTATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001917181 Original CRISPR ATGCAGGAGCAGGGAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr