ID: 1001919797

View in Genome Browser
Species Human (GRCh38)
Location 5:175590903-175590925
Sequence CAGAGGCTGCTAGGCCGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001919797_1001919802 18 Left 1001919797 5:175590903-175590925 CCGGCACGGCCTAGCAGCCTCTG No data
Right 1001919802 5:175590944-175590966 GCTTCCCCACCTTCTTTAGAGGG No data
1001919797_1001919801 17 Left 1001919797 5:175590903-175590925 CCGGCACGGCCTAGCAGCCTCTG No data
Right 1001919801 5:175590943-175590965 TGCTTCCCCACCTTCTTTAGAGG No data
1001919797_1001919806 26 Left 1001919797 5:175590903-175590925 CCGGCACGGCCTAGCAGCCTCTG No data
Right 1001919806 5:175590952-175590974 ACCTTCTTTAGAGGGCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001919797 Original CRISPR CAGAGGCTGCTAGGCCGTGC CGG (reversed) Intergenic
No off target data available for this crispr