ID: 1001919800

View in Genome Browser
Species Human (GRCh38)
Location 5:175590920-175590942
Sequence GTAGAAGACCTTTCATGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001919800_1001919809 22 Left 1001919800 5:175590920-175590942 CCTCTGCATGAAAGGTCTTCTAC No data
Right 1001919809 5:175590965-175590987 GGCCAAGAGGAGCAGGTCCCTGG No data
1001919800_1001919808 15 Left 1001919800 5:175590920-175590942 CCTCTGCATGAAAGGTCTTCTAC No data
Right 1001919808 5:175590958-175590980 TTTAGAGGGCCAAGAGGAGCAGG No data
1001919800_1001919806 9 Left 1001919800 5:175590920-175590942 CCTCTGCATGAAAGGTCTTCTAC No data
Right 1001919806 5:175590952-175590974 ACCTTCTTTAGAGGGCCAAGAGG No data
1001919800_1001919801 0 Left 1001919800 5:175590920-175590942 CCTCTGCATGAAAGGTCTTCTAC No data
Right 1001919801 5:175590943-175590965 TGCTTCCCCACCTTCTTTAGAGG No data
1001919800_1001919802 1 Left 1001919800 5:175590920-175590942 CCTCTGCATGAAAGGTCTTCTAC No data
Right 1001919802 5:175590944-175590966 GCTTCCCCACCTTCTTTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001919800 Original CRISPR GTAGAAGACCTTTCATGCAG AGG (reversed) Intergenic
No off target data available for this crispr