ID: 1001919801

View in Genome Browser
Species Human (GRCh38)
Location 5:175590943-175590965
Sequence TGCTTCCCCACCTTCTTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001919797_1001919801 17 Left 1001919797 5:175590903-175590925 CCGGCACGGCCTAGCAGCCTCTG No data
Right 1001919801 5:175590943-175590965 TGCTTCCCCACCTTCTTTAGAGG No data
1001919800_1001919801 0 Left 1001919800 5:175590920-175590942 CCTCTGCATGAAAGGTCTTCTAC No data
Right 1001919801 5:175590943-175590965 TGCTTCCCCACCTTCTTTAGAGG No data
1001919796_1001919801 18 Left 1001919796 5:175590902-175590924 CCCGGCACGGCCTAGCAGCCTCT No data
Right 1001919801 5:175590943-175590965 TGCTTCCCCACCTTCTTTAGAGG No data
1001919798_1001919801 8 Left 1001919798 5:175590912-175590934 CCTAGCAGCCTCTGCATGAAAGG No data
Right 1001919801 5:175590943-175590965 TGCTTCCCCACCTTCTTTAGAGG No data
1001919795_1001919801 24 Left 1001919795 5:175590896-175590918 CCAGAACCCGGCACGGCCTAGCA No data
Right 1001919801 5:175590943-175590965 TGCTTCCCCACCTTCTTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001919801 Original CRISPR TGCTTCCCCACCTTCTTTAG AGG Intergenic
No off target data available for this crispr