ID: 1001919802

View in Genome Browser
Species Human (GRCh38)
Location 5:175590944-175590966
Sequence GCTTCCCCACCTTCTTTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001919800_1001919802 1 Left 1001919800 5:175590920-175590942 CCTCTGCATGAAAGGTCTTCTAC No data
Right 1001919802 5:175590944-175590966 GCTTCCCCACCTTCTTTAGAGGG No data
1001919795_1001919802 25 Left 1001919795 5:175590896-175590918 CCAGAACCCGGCACGGCCTAGCA No data
Right 1001919802 5:175590944-175590966 GCTTCCCCACCTTCTTTAGAGGG No data
1001919797_1001919802 18 Left 1001919797 5:175590903-175590925 CCGGCACGGCCTAGCAGCCTCTG No data
Right 1001919802 5:175590944-175590966 GCTTCCCCACCTTCTTTAGAGGG No data
1001919798_1001919802 9 Left 1001919798 5:175590912-175590934 CCTAGCAGCCTCTGCATGAAAGG No data
Right 1001919802 5:175590944-175590966 GCTTCCCCACCTTCTTTAGAGGG No data
1001919796_1001919802 19 Left 1001919796 5:175590902-175590924 CCCGGCACGGCCTAGCAGCCTCT No data
Right 1001919802 5:175590944-175590966 GCTTCCCCACCTTCTTTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001919802 Original CRISPR GCTTCCCCACCTTCTTTAGA GGG Intergenic
No off target data available for this crispr