ID: 1001919808

View in Genome Browser
Species Human (GRCh38)
Location 5:175590958-175590980
Sequence TTTAGAGGGCCAAGAGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001919800_1001919808 15 Left 1001919800 5:175590920-175590942 CCTCTGCATGAAAGGTCTTCTAC No data
Right 1001919808 5:175590958-175590980 TTTAGAGGGCCAAGAGGAGCAGG No data
1001919798_1001919808 23 Left 1001919798 5:175590912-175590934 CCTAGCAGCCTCTGCATGAAAGG No data
Right 1001919808 5:175590958-175590980 TTTAGAGGGCCAAGAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001919808 Original CRISPR TTTAGAGGGCCAAGAGGAGC AGG Intergenic
No off target data available for this crispr