ID: 1001919809

View in Genome Browser
Species Human (GRCh38)
Location 5:175590965-175590987
Sequence GGCCAAGAGGAGCAGGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001919798_1001919809 30 Left 1001919798 5:175590912-175590934 CCTAGCAGCCTCTGCATGAAAGG No data
Right 1001919809 5:175590965-175590987 GGCCAAGAGGAGCAGGTCCCTGG No data
1001919800_1001919809 22 Left 1001919800 5:175590920-175590942 CCTCTGCATGAAAGGTCTTCTAC No data
Right 1001919809 5:175590965-175590987 GGCCAAGAGGAGCAGGTCCCTGG No data
1001919803_1001919809 -6 Left 1001919803 5:175590948-175590970 CCCCACCTTCTTTAGAGGGCCAA No data
Right 1001919809 5:175590965-175590987 GGCCAAGAGGAGCAGGTCCCTGG No data
1001919805_1001919809 -8 Left 1001919805 5:175590950-175590972 CCACCTTCTTTAGAGGGCCAAGA No data
Right 1001919809 5:175590965-175590987 GGCCAAGAGGAGCAGGTCCCTGG No data
1001919804_1001919809 -7 Left 1001919804 5:175590949-175590971 CCCACCTTCTTTAGAGGGCCAAG No data
Right 1001919809 5:175590965-175590987 GGCCAAGAGGAGCAGGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001919809 Original CRISPR GGCCAAGAGGAGCAGGTCCC TGG Intergenic
No off target data available for this crispr