ID: 1001920428

View in Genome Browser
Species Human (GRCh38)
Location 5:175595568-175595590
Sequence ATGGTTCAGCAGAGGCAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001920428_1001920434 28 Left 1001920428 5:175595568-175595590 CCTCATTGCCTCTGCTGAACCAT No data
Right 1001920434 5:175595619-175595641 GTTCAAGCTGCCATCTTCTCTGG No data
1001920428_1001920431 6 Left 1001920428 5:175595568-175595590 CCTCATTGCCTCTGCTGAACCAT No data
Right 1001920431 5:175595597-175595619 TAACCTGCGACTCTTCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001920428 Original CRISPR ATGGTTCAGCAGAGGCAATG AGG (reversed) Intergenic
No off target data available for this crispr