ID: 1001923009

View in Genome Browser
Species Human (GRCh38)
Location 5:175615515-175615537
Sequence CTATAAACACGGCTGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001923009_1001923013 6 Left 1001923009 5:175615515-175615537 CCCAGCTACAGCCGTGTTTATAG No data
Right 1001923013 5:175615544-175615566 TACTCACAATAGCCAAAAGGTGG 0: 22
1: 355
2: 1117
3: 2387
4: 6978
1001923009_1001923012 3 Left 1001923009 5:175615515-175615537 CCCAGCTACAGCCGTGTTTATAG No data
Right 1001923012 5:175615541-175615563 CATTACTCACAATAGCCAAAAGG 0: 32
1: 422
2: 1118
3: 1626
4: 1854

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001923009 Original CRISPR CTATAAACACGGCTGTAGCT GGG (reversed) Intergenic
No off target data available for this crispr